interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación al desarrollo de sensores


Save this PDF as:
 WORD  PNG  TXT  JPG

Tamaño: px
Comenzar la demostración a partir de la página:

Download "interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación al desarrollo de sensores"

Transcripción

1 Facultad de Ciencias Departamento de Química Analítica y Análisis Instrumental interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación al desarrollo de sensores Iria Bravo Segura Madrid, 2017

2

3 UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE QUÍMICA ANALÍTICA Y ANÁLISIS INSTRUMENTAL Interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación al desarrollo de sensores Iria Bravo Segura Tesis Doctoral Madrid, Octubre de 2017

4 UNIVERSIDAD AUTÓNOMA DE MADRID FACULTAD DE CIENCIAS DEPARTAMENTO DE QUÍMICA ANALÍTICA Y ANÁLISIS INSTRUMENTAL Interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación al desarrollo de sensores Memoria que presenta la licenciada Iria Bravo Segura para optar al grado de Doctor

5 Dña. María Encarnación Lorenzo Abad, Doctora en Ciencias Químicas y Catedrática del Departamento de Química Analítica y Análisis Instrumental de la Universidad Autónoma de Madrid, y D. Félix Pariente Alonso, Doctor en Ciencias Químicas y Profesor Titular del mismo departamento: Informamos que la presente memoria, titulada: Interacción de nanoestructuras de carbono o metálicas con (bio)moléculas y su aplicación del desarrollo de sensores ha sido desarrollada por Dña. Iria Bravo Segura en el Departamento de Química Analítica y Análisis Instrumental de la Universidad Autónoma de Madrid, bajo nuestra dirección. Asimismo, hacemos constar que el trabajo descrito en dicha memoria reúne, en nuestra opinión, todos los requisitos para su defensa y aprobación, por lo que, como directores del trabajo de investigación, autorizamos su presentación para que pueda ser defendida por el doctorando como Tesis Doctoral en acto público en el Departamento de Química Analítica y Análisis Instrumental de la Universidad Autónoma de Madrid. Y para que conste firmamos el presente documento en Madrid, a 11 de septiembre de Fdo. Mª Encarnación Lorenzo Abad Fdo. Félix Pariente Alonso

6 Agradecimientos Me gustaría agradecer en estas líneas a todas las personas que me han ayudado a llevar a cabo este trabajo. A mis directores de tesis, Dra. Encarnación Lorenzo y Dr. Félix Pariente, cuya colaboración ha sido vital en el desarrollo de este trabajo. Me han aportado sus conocimientos y experiencia, además de su apoyo y paciencia, y me han abierto las puertas del mundo de la investigación. Al Ministerio de Economía y Competitividad por la oportunidad de disfrutar de una beca FPI para la realización de esta tesis, a la empresa Digna Biotech por la financiación de un contrato de investigación y al Ministerio de Educación por la concesión de una beca de colaboración. A Mónica y Tania, por todo lo que me habéis ayudado, los consejos, la experiencia y la paciencia infinita. También a José María Abad por orientarme en muchos momentos. A mis compañeros y amigos científicos, César, Emiliano, María y Marta, por los buenos ratos y las risas, además de vuestro apoyo en todo momento. A mis amigos, tanto de Vigo como de Madrid, por todos los momentos compartidos y por animarme siempre a seguir adelante. A mi familia, a la de siempre y a la nueva, por el apoyo incondicional y la confianza. Especialmente, quiero agradecer a mis padres absolutamente todo. No sería capaz de enumerar todas las cosas por las que os estoy agradecida. A Marki, muchas gracias por tu apoyo, tu cariño, tu confianza absoluta y por darme un empujón cuando me faltan las fuerzas. Gracias por hacer siempre que me sienta bien.

7 Índice

8 Índice RESUMEN / ABSTRACT... 1 Resumen... 3 Abstract... 7 INTRODUCCIÓN I.1. Electrodos modificados químicamente. Sensores electroquímicos I.1.1 Métodos de modificación de electrodos I.2. Electrodos modificados con nanomateriales I.2.1 Nanopartículas de oro I.2.2 Grafeno I.2.3 Nanotubos de carbono I.2.4 Nanopuntos de carbono I.2.5 Funcionalización de nanomateriales de carbono I.3. Electrodos modificados con biomoléculas. Biosensores I.3.1 Biosensores enzimáticos I.3.2 Biosensores electroquímicos de ADN I.4 Aplicación analítica de los electrodos modificados OBJETIVOS MATERIALES Y MÉTODOS M.1. Reactivos, disoluciones y dispersiones M.1.1 Reactivos Comerciales M.1.2 Reactivos sintetizados M.1.3 Disoluciones M.1.4 Dispersiones M.1.5 Muestras reales M.1.6 Ácidos desoxirribonucleicos (ADN) M.2. Instrumentación M.2.1 Espectrofotómetro M.2.2 Espectrofluorímetro M.2.3 Potenciostato M.2.4 Microscopio electrónico de barrido (SEM)... 72

9 Índice M.2.5 Microscopio de fuerzas atómicas (AFM) M.2.6 Espectrófotometro FTIR M.2.7 Microscopio electrónico de transmisión (TEM) M.2.8 Espectrómetro Raman M.2.9 Instrumentación para dispersión de luz dinámica (DLS) M.2.10 Instrumentación para medida del potencial Zeta M.2.11 Instrumentación para análisis elemental M.3. Procedimientos experimentales M.3.1 Pretratamiento de los electrodos M.3.2 Modificación de electrodos con nanotubos de carbono M.3.3 Modificación de las plataformas basadas en MWCNTs con 3,4-DHS M.3.4 Síntesis de grafeno reducido con 3,4-DHS M.3.5 Reducción de grafeno oxidado con borohidruro sódico (NaBH 4 ) M.3.6 Reducción de grafeno oxidado con hidrazina M.3.7 Modificación de electrodos con grafeno reducido químicamente M.3.8 Síntesis de nanopartículas de oro utilizando 3,4-DHS como reductor M.3.9 Determinación del tamaño de las nanopartículas de oro M.3.10 Modificación de electrodos con AuNPs-DHS M.3.11 Preparación del biosensor de lactato M.3.12 Determinación de lactato mediante el kit enzimático M.3.13 Estimación de la concentración de CNDs M.3.14 Modificación de electrodos con CNDs M.3.15 Inmovilización de ADN sobre los electrodos nanoestructurados M.3.16 Preparación del biosensor de ADN M.3.17 Desnaturalización de las muestras de ADN de PCR M.3.18 Hibridación de ADN en el biosensor M.3.19 Detección del evento de hibridación en el biosensor de ADN M.3.20 Determinación de la temperatura de desnaturalización (T m ) M.4. Cálculo de parámetros y constantes de interés M.4.1 Determinación del área del electrodo electroquímicamente activa M.4.2 Recubrimiento superficial del material depositado sobre la superficie del electrodo... 82

10 Índice M.4.3 Constante heterogénea de transferencia de carga. Especies inmovilizadas sobre la superficie del electrodo M.4.4 Constante catalítica mediante el método de Galus M.4.5 Coeficiente de difusión M.4.6 Deconvolución de bandas RESULTADOS Y DISCUSIÓN CAPÍTULO 1 1. Plataformas electrocatalíticas basadas en nanotubos de carbono y en la química de las sales de diazonio Inmovilización de los MWCNTs sobre los electrodos Nanoestructuración de los electrodos según la estrategia Nanoestructuración de los electrodos según la estrategia Nanoestructuración de los electrodos según la estrategia Nanoestructuración de los electrodos según la estrategia Nanoestructuración de los electrodos según la estrategia Caracterización de los electrodos nanoestructurados con nanotubos de carbono Caracterización de los electrodos nanoestructurados mediante microscopía electrónica de barrido (SEM) Caracterización de los electrodos nanoestructurados mediante microscopía de fuerzas atómicas (AFM) Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica Modificación con 3,4-DHS de las plataformas basadas en MWCNTs Modificación de AuSPEs con 3,4-DHS Modificación de CSPEs con 3,4-DHS Propiedades electrocatalíticas de las plataformas SPE/MWCNTs/ 3,4-DHS Oxidación electrocatalítica de NADH Oxidación electrocatalítica de hidrazina

11 Índice CAPÍTULO 2 2. Reducción y modificación química de grafeno en un solo paso para el desarrollo de plataformas (bio)electrocatalíticas Interacción de óxido de grafeno con 3,4-DHS Reducción de óxido de grafeno con 3,4-DHS Efecto de la concentración de 3,4-DHS en la reducción de óxido de grafeno Efecto del tiempo de reacción en la reducción de óxido de grafeno con 3,4-DHS Caracterización del material sintetizado Caracterización de rgo-dhs mediante espectrofotometría de absorción y emisión Caracterización de rgo-dhs mediante espectroscopía Raman Desarrollo de electrodos modificados con rgo-dhs Caracterización de los electrodos nanoestructurados con rgo-dhs mediante voltamperometría cíclica Caracterización de los electrodos modificados con grafeno mediante espectroscopía de impedancia electroquímica (EIS) Aplicaciones analíticas de los electrodos modificados desarrollados Oxidación electrocatalítica de hidrazina Desarrollo de un biosensor de lactato CAPÍTULO 3 3. Síntesis de nanopartículas de oro con 3,4-DHS Síntesis de nanopartículas de oro utilizando 3,4-DHS como reductor Efecto de la relación molar de HAuCl 4 y 3,4-DHS Efecto del ph en la síntesis de nanopartículas de oro Influencia de la temperatura Estudio cinético de la formación de las nanopartículas de oro Caracterización de las nanopartículas sintetizadas Caracterización mediante espectrofotometría Caracterización mediante espectroscopía de infrarrojo (FTIR)

12 Índice Caracterización mediante espectroscopía Raman Caracterización mediante microscopía electrónica de transmisión (TEM) Propiedades electrocatalíticas de las plataformas CSPEs/AuNPs-DHS Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica Oxidación electrocatalítica de hidrazina Oxidación electrocatalítica de peróxido de hidrógeno Desarrollo de un biosensor de lactato Desarrollo y respuesta del biosensor Respuesta del biosensor Estudio de sustancias potencialmente interferentes Determinación directa de lactato en muestras reales CAPÍTULO 4 4. Nanopuntos de carbono para la detección de mutaciones genéticas Síntesis y caracterización de los nanopuntos de carbono Caracterización mediante espectroscopía de infrarrojo (FTIR) Caracterización mediante dispersión de luz dinámica (DLS) Caracterización mediante análisis elemental Caracterización mediante potencial Zeta Caracterización mediante TEM Caracterización mediante espectroscopía Raman Caracterización mediante espectrofotometría Interacción de los nanopuntos de carbono con ADN Estudio de la interacción de los CDs con ADN mediante espectrofotometría de emisión de fluorescencia Estudio de la temperatura de desnaturalización Nanoestructuración del electrodo Caracterización morfológica de la superficie nanoestructurada mediante SEM

13 Índice Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica Aplicaciones analíticas de los AuSPE nanoestructurados con CDs Desarrollo de un biosensor nanoestructurado de ADN Detección de secuencias de Helicobacter pylori Detección de mutaciones genéticas asociadas a la fibrosis quística CONCLUSIONES / CONCLUSIONS Conclusiones Conclusions BIBLIOGRAFÍA PUBLICACIONES...301

14 Resumen Abstract

15 Resumen Resumen El objetivo principal de este trabajo de tesis es el uso de nanomateriales para la modificación de electrodos con la finalidad de desarrollar sensores y biosensores electroquímicos sensibles y robustos. Para ello se han utilizado diferentes nanomateriales, que pueden estar funcionalizados o no, y son: nanotubos de carbono, grafeno, nanopartículas de oro y nanopuntos de carbono. Se estudiaron diferentes estrategias de modificación de la superficie de electrodos serigrafiados de oro y de carbono con nanotubos de carbono de pared múltiple (MWCNTs). La estrategia 1 consistió en la diazotación y electroinjerto de MWCNTs aminados sobre electrodos de oro y carbono. Para las estrategias 2, 3 y 4 se modificó la superficie de oro con 4-aminotiofenol, de manera que queden grupos amino expuestos hacia la disolución. Estos grupos amino se sometieron al proceso de diazotación en las estrategias 2 y 3 y, a continuación, se electroinjertaron sobre MWCNTs no modificados (estrategia 2) o se hicieron reaccionar con MWCNTs aminados formando un enlace triazeno (estrategia 3). La estrategia 4 se basó en la formación de un enlace entre amida con MWCNTs carboxilados. Por último, a modo de comparación, se estudió como estrategia 5 la adsorción directa de los MWCNTs sobre la superficie de los electrodos serigrafiados de oro y carbono. Las superficies se caracterizaron mediante SEM, AFM y voltamperometría cíclica. Posteriormente, con el objeto de mejorar sus propiedades electrocatalíticas, los electrodos nanoestructurados se modificaron con N,N-bis(3,4-dihidroxibenciliden)-1,2- diaminobenceno (3,4-DHS) por adsorción directa. Se estudió la actividad electrocatalítica frente a la oxidación de NADH e hidrazina, concluyéndose que los mejores resultados se obtienen con las plataformas desarrolladas siguiendo la estrategia 1 en presencia de 3,4-DHS. Por tanto, estas plataformas se utilizaron para desarrollar dos sensores, uno de NADH, para lo que se emplearon electrodos serigrafiados de oro y otro de hidrazina, para lo que se utilizaron electrodos serigrafiados de carbono. Se obtuvieron buenos resultados para ambos analitos, con unos límites de detección de 3.4 y 6.0 µm, respectivamente. El 3,4-DHS también se empleó con una doble función, reductor y funcionalizador, en la reducción de óxido de grafeno (GO) para producir directamente grafeno modificado 3

16 Resumen químicamente (rgo-dhs) mediante un tratamiento térmico. El material resultante se caracterizó mediante diferentes técnicas, confirmando, por un lado, la reducción del GO y, por otro, la presencia del 3,4-DHS en su superficie. Se modificaron electrodos serigrafiados de carbono con rgo-dhs y se caracterizaron mediante técnicas electroquímicas, observándose un comportamiento diferente al comparar con electrodos modificados con GO. Concretamente, los electrodos modificados con rgo-dhs presentan una menor resistencia a la transferencia de carga. Además, los electrodos modificados con rgo-dhs presentan propiedades electrocatalíticas frente a la oxidación de hidrazina, lo que se utilizó como base para el desarrollo de un sensor para la determinación de este analito. Se obtuvieron buenas propiedades analíticas, con un límite de detección de 0.20 µm. También se han empleado estos electrodos para la construcción de un biosensor amperométrico de lactato tras modificar la superficie nanoestructurada con la enzima lactato oxidasa (LOx). El 3,4-DHS que se encuentra adsorbido sobre la superficie del grafeno contiene grupos quinona y puede actuar como un mediador redox, aceptando los electrones involucrados en la oxidación enzimática de lactato. De esta manera, es posible reducir el sobrepotencial y evitar los problemas derivados de la presencia de sustancias potencialmente interferentes. De hecho, el estudio de la influencia de estas sustancias sobre la respuesta del biosensor reveló que su presencia no afecta significativamente, incluso cuando se encuentran en concentración igual al analito, excepto en el caso del ácido ascórbico. El biosensor desarrollado se empleó en la determinación directa de lactato en muestras reales de vino blanco, sin necesidad de procesos de separación previa, únicamente fue necesario realizar una dilución de la muestra. De manera similar al caso de GO, se utilizó el 3,4-DHS como reductor en la síntesis de nanopartículas de oro funcionalizadas (AuNPs-DHS) a partir de una sal. En este caso, la reacción transcurrió a temperatura ambiente. La molécula de 3,4-DHS actúa, además de como reductor, como estabilizante, permitiendo la formación de una suspensión coloidal estable mediante una reacción de un único paso. Se optimizaron los parámetros de síntesis, tales como concentración, ph o temperatura y las nanopartículas sintetizadas se caracterizaron mediante diferentes técnicas. Esto 4

17 Resumen permitió confirmar que las nanopartículas tienen un tamaño medio de 33 ± 3 nm y que se encuentran rodeadas por moléculas de 3,4-DHS unidas al oro a través de los grupos fenolato y que alrededor de ellas se forma una capa de moléculas de 3,4-DHS en su forma oxidada. Cuando las nanoestructuras AuNPs-DHS se depositan sobre electrodos serigrafiados de carbono presentan actividad electrocatalítica frente a la oxidación de hidrazina y la oxidación y reducción de peróxido de hidrógeno. Los sensores desarrollados para ambos analitos presentan unas propiedades analíticas excelentes, obteniéndose unos límites de detección de 22 nm, 0.15 µm y 0.32 µm para la oxidación de hidrazina y oxidación y reducción de peróxido, respectivamente, además de unos intervalos lineales muy amplios y una buena reproducibilidad. Además, se construyó un biosensor de lactato modificando los electrodos nanoestructurados con AuNPs-DHS con la enzima LOx. A diferencia del biosensor desarrollado con rgo-dhs, en este caso, la determinación de lactato se realiza a través de la cuantificación del peróxido generado enzimáticamente, cuya oxidación está catalizada por las AuNPs-DHS. El biosensor desarrollado presenta un límite de detección de 2.6 µm, una buena reproducibilidad y una elevada selectividad. Este biosensor se aplicó en la determinación de lactato directamente en muestras reales de vino blanco, cerveza y yogur, con una dilución como único tratamiento de muestra. Se obtuvieron recuperaciones cercanas al 100% al comparar los resultados con los obtenidos con un kit enzimático comercial. Por otro lado se sintetizaron nanopuntos de carbono (CDs) mediante la carbonización térmica de dos moléculas orgánicas sencillas, EGTA y Tris. La caracterización mediante diferentes técnicas permitió determinar que los CDs sintetizados tienen un tamaño medio de 3.4 ± 0.5 nm y que presentan grupos amida y alcohol. Se estudió la interacción de los CDs con ADN, observándose que la presencia de este provoca una amortiguación de la fluorescencia de los CDs. Se modificaron electrodos serigrafiados de oro con los CDs y se caracterizaron. Estos electrodos nanoestructurados se modificaron con una sonda de ADN no modificada de 25 bases correspondiente a la bacteria Helicobacter pylori. Tras su incubación con una secuencia complementaria o no complementaria se acumuló el indicador electroquímico, safranina, mediante la 5

18 Resumen aplicación de barridos sucesivos de potencial. La señal obtenida para el electrodo modificado con la sonda e incubado con la secuencia complementaria fue mucho mayor que la obtenida para la secuencia no complementaria, demostrando que los electrodos nanoestructurados sirven como plataforma para la inmovilización de sondas de ADN no modificadas que mantienen su capacidad de reconocimiento. Además, cuando la sonda se hibrida con una secuencia que contiene una sola base no complementaria, la señal es menor que para la complementaria y mayor que para la no complementaria, por lo que se puede afirmar que el biosensor desarrollado es capaz de detectar mutaciones puntuales en una secuencia de 25 bases. El biosensor de ADN desarrollado se aplicó a la detección de mutaciones asociadas a la fibrosis quística en ADN real de PCR extraído de células sanguíneas. Para ello, se modificó el electrodo nanoestructurado con una sonda de ADN de 100 bases complementaria a un fragmento de 373 bases del exón 11 del gen regulador de la conductancia transmembrana de la fibrosis quística (CFTR). Esta sonda se incubó con una secuencia complementaria, correspondiente a pacientes sanos, y con una secuencia que contiene una mutación consistente en la deleción de tres nucleótidos, que es la causante de la enfermedad en la mayoría de los casos. La señal obtenida tras la acumulación de la safranina fue aproximadamente el doble para la secuencia complementaria que para la mutada, confirmando que el biosensor desarrollado es capaz de diferenciar entre secuencias que porten o no la mutación. Es decir, permite diferenciar entre pacientes sanos y enfermos, por lo que puede ser utilizado como método de cribado en la detección de enfermedades asociadas a mutaciones genéticas. 6

19 Abstract Abstract The main objective of this thesis work is the use of nanomaterials for the modification of electrodes with the aim of developing sensitive and robust electrochemical sensors and biosensors. Different nanomaterials, which can be functionalized or not, have been used in order to achieve this goal. These include carbon nanotubes, graphene, gold nanoparticles and carbon nanodots. Different strategies were studied for the modification of gold and carbon screen printed electrodes surfaces with multiwalled carbon nanotubes (MWCNTs). Strategy 1 was based in the diazotization and electrografting of aminated MWCNTs onto carbon and gold electrodes. For the strategies 2, 3 and 4 the gold surface was modified with 4- aminothiophenol, leaving the amino groups exposed to the solution. These amino groups were diazotized in strategies 2 and 3 and they were subsequently electrografted onto non modified MWCNTs (strategy 2) or reacted with aminated MWCNTs thus forming a triazene bond (strategy 3). Strategy 4 was based on the formation of an amide bond with carboxylated MWCNTs. Finally, by way of comparison, strategy 5 was studied, which consists of the MWCNTs direct adsorption onto the gold and carbon screen printed electrodes surface. These modified surfaces were characterized by SEM, AFM and cyclic voltammetry. Afterwards, with the purpose of improving their electrocatalytic properties, the nanostructured electrodes were modified with N,N-bis(3,4-dihydroxibenzylidene)-1,2-diaminobenzene (3,4-DHS) by direct adsorption. The electrocatalytic activity was studied towards NADH and hydrazine oxidation. The best results were obtained with the platforms developed following strategy 1 in the presence of 3,4-DHS. Therefore, these platforms were used to develop two sensors, a NADH one, using gold screen printed electrodes and a hydrazine one, using carbon screen printed electrodes. Good results were obtained for both analytes, with detection limits of 3.4 and 6.0 µm, respectively. 3,4-DHS was also employed with a double function, reductant and functionalizer, in the reduction of graphene oxide (GO) to produce directly chemically modified graphene (rgo-dhs) by a thermal treatment. The resulting material was characterized by different techniques, confirming, on one hand, the GO reduction and, on the other hand, the presence of 3,4-DHS on its surface. Carbon screen printed 7

20 Abstract electrodes were modified with rgo-dhs and characterized by electrochemical techniques. A different behavior was observed when compared to GO modified electrodes, in particular, rgo-dhs modified electrodes showed a smaller charge transfer resistance. Moreover, rgo-dhs modified electrodes exhibit electrocatalytic properties towards hydrazine oxidation, which was used for the development of a sensor for this analyte determination. Good analytical properties were obtained, with a detection limit of 0.20 µm. These electrodes were also used for the construction of an amperometric biosensor for lactate determination after modifying the nanostructured surface with the enzyme lactate oxidase (LOx). The 3,4-DHS adsorbed onto the graphene surface contains quinone groups and can act as a redox mediator, accepting the electrons involved in the lactate enzymatic reaction. This way, the overpotential can be reduced and issues derived from the presence of potential interfering substances can be avoided. In fact, the study of these substances influence over the biosensor response revealed that their presence does not affect significantly, even when they match the analyte concentration, except in the case of ascorbic acid. The developed biosensor was employed in the direct lactate determination in white wine real samples, without the need of previous separation processes, only a sample dilution was necessary. In a similar way to the case of GO, 3,4-DHS was used as a reductant in the functionalized gold nanoparticles (AuNPs-DHS) synthesis from a salt. In this case, the reaction occurred at room temperature. The 3,4-DHS molecule acts, not only as a reductant, but also as a stabilizer in the formation of a stable colloidal suspension in a one-step reaction. Synthesis parameters, such as concentration, ph or temperature, were optimized and the synthesized nanoparticles were characterized by different techniques. This confirmed that the nanoparticles have a mean diameter of 33 ± 3 nm and that they are surrounded by 3,4-DHS molecules bonded to the gold through the phenolate groups and that an outer layer is formed composed of 3,4-DHS molecules in their oxidized form. When the AuNPs-DHS nanostructures are deposited onto carbon screen printed electrodes they show electrocatalytic activity towards hydrazine oxidation and hydrogen peroxide oxidation and reduction. The developed sensors for both analytes 8

21 Abstract show excellent analytical properties. Detection limits of 22 nm, 0.15 µm and 0.32 µm were obtained for hydrazine oxidation and hydrogen peroxide oxidation and reduction, respectively, as well as wide linear ranges and a good reproducibility. In addition, a lactate biosensor was developed by modification of AuNPs-DHS nanostructured electrodes with the enzyme LOx. As opposed to the biosensor developed using rgo-dhs, in this case, lactate determination was carried out by measuring the enzymatically generated peroxide, whose oxidation is catalyzed by AuNPs-DHS. The developed biosensor shows a detection limit of 2.6 µm, a good reproducibility and a high selectivity. This biosensor was applied to the direct lactate determination in white wine, beer and yoghurt real samples, with a dilution as the only sample treatment. Recoveries near 100% were obtained when the results were compared to the ones obtained using a commercial enzymatic kit. Furthermore, carbon nanodots (CDs) were synthesized by thermal carbonization of two simple organic molecules, EGTA and Tris. Characterization by different techniques determined an average size of 3.4 ± 0.5 nm and that the synthesized CDs contain amide and alcohol groups. The interaction between CDs and DNA was studied, observing that the presence of the latter causes a quenching in the CDs fluorescence. Screen printed gold electrodes were modified with the CDs and characterized. These nanostructured electrodes were modified with a 25-base non modified DNA probe corresponding to the Helicobacter pylori bacteria. After their incubation with a complementary or non-complementary sequence the redox indicator, safranine, was accumulated by applying successive potential cycles. The signal obtained for the probe modified electrode incubated with the complementary sequence was much higher than that obtained for the non-complementary sequence, proving that the nanostructured electrodes serve as a platform for non-modified DNA probes that keep their recognition capability. In addition, when the probe is hybridized with a sequence containing a single mismatch, the signal is lower than that of the complementary sequence and higher than that of the non-complementary. This confirms that the developed biosensor is capable of detecting single mutations in a 25-base sequence. The developed DNS biosensor was applied to the detection of mutations associated to cystic fibrosis in real PCR DNA samples extracted from blood 9

22 Abstract cells. For that purpose, the nanostructured electrode was modified with a 100-base sequence complementary to a 373-base fragment of from then exon 11 of the cystic fibrosis transmembrane regulator (CFTR) gene. This probe was incubated with a complementary sequence, corresponding to healthy patients, and with a sequence containing a mutation consisting of a three nucleotide deletion, which is the most common cause of this illness. The signal obtained after safranine accumulation for the complementary sequence was approximately twice as high as that obtained for the mutated one. This confirms that the developed biosensor is capable of distinguishing between sequences containing the mutation or not. That means that it is capable of differentiating between healthy and unhealthy patients, therefore it could be used as a screening method for the detection of illnesses associated to gene mutations. 10

23 Introducción

24 Introducción La creciente demanda de métodos de análisis rápidos y económicos, que permitan la detección de analitos de interés fuera del laboratorio en sectores como el clínico, agroalimentario, industrial, medioambiental o forense ha dirigido la investigación en química analítica hacia el desarrollo de dispositivos sensores que satisfagan estas necesidades. Con el propósito de mejorar las propiedades analíticas de estos, recientemente se han incorporado materiales nanométricos en su diseño. Por este motivo, existe un gran interés en el desarrollo de nuevos nanomateriales químicamente funcionalizados que permitan la construcción de sensores y biosensores sensibles, estables y robustos. I.1. Electrodos modificados químicamente. Sensores electroquímicos Un sensor químico, según la IUPAC, se define como un dispositivo que transforma información química, desde la concentración de un componente específico en una muestra hasta el análisis total de la composición, en una señal analítica útil. Esta información química puede estar originada por una reacción química del analito o por una propiedad física del sistema investigado [Hulanicki, 1991]. Un sensor químico se compone de un elemento químico de reconocimiento y un transductor. El elemento de reconocimiento reconoce al analito en una muestra y, como consecuencia, se produce un cambio en las propiedades químico-físicas del sistema, que el transductor transforma en una señal de utilidad analítica. Un caso particular lo forman el grupo de los biosensores, en los que el elemento de reconocimiento es de tipo biológico. Este tipo de sensores tiene una gran importancia, por lo que serán tratados con mayor detalle en esta introducción. Cuando el transductor empleado es de tipo electroquímico se denomina electrodo y el dispositivo resultante, sensor electroquímico. Los sensores electroquímicos, comparados con otros tipos de sensores tales como ópticos, térmicos o piezoeléctricos, son especialmente atractivos ya que presentan una serie de ventajas, como son su fabricación sencilla y económica, su sensibilidad, robustez, amplio intervalo de linealidad y tiempos de respuesta cortos, además de ser fácilmente miniaturizables, lo que permite desarrollar dispositivos portátiles y fáciles de integrar en sistemas de análisis automático. 13

25 Introducción Además, otra de las ventajas es la gran variedad de materiales disponibles para la fabricación de electrodos para diferentes aplicaciones [Alegret, 2004]. Los materiales más utilizados en la fabricación de electrodos son metales, óxidos de metales, carbono en diferentes formas y también, aunque menos utilizados, polímeros [Scholz, 2010]. Sin embargo, es importante destacar que, a pesar de que con ellos es posible realizar determinaciones muy sensibles para algunos analitos, los electrodos por sí mismos carecen de selectividad. Por este motivo, con el objeto de dotar a los electrodos de selectividad, en los años 70 comenzaron las investigaciones sobre electrodos modificados químicamente [Lane, 1973a; Lane, 1973b; Moses, 1975; Watkins, 1975]. La modificación de la superficie se realiza con la intención de conseguir un electrodo apropiado para una determinada función, cuyas propiedades son diferentes de las del electrodo sin modificar, es decir, que las características y la respuesta electroquímica dependen de esta modificación. Concretamente, en el campo de los sensores electroquímicos se pretende dotar al dispositivo de selectividad, evitar efectos de envenenamiento del electrodo, preconcentrar el analito y dotarle de propiedades electrocatalíticas [Malinauskas, 1999]. Por tanto, el material modificador se elige con el objetivo de que sea selectivo a un analito determinado o de que actúe como mediador en reacciones que transcurren de manera lenta o, incluso, que se encuentran inhibidas sobre el electrodo sin modificar. Es decir, los electrodos modificados químicamente, en comparación con los electrodos sin modificar, permiten obtener cinéticas de transferencia de carga entre el analito y la superficie del electrodo más rápidas y presentan mejores propiedades analíticas, tales como selectividad, sensibilidad y estabilidad, lo que permite obtener una respuesta adecuada a las necesidades analíticas [Kutner, 1998]. I.1.1 Métodos de modificación de electrodos Para dotar al electrodo de las características necesarias para la aplicación deseada se lleva a cabo la modificación de la superficie del electrodo con distintos materiales mediante diferentes estrategias. Se ha descrito una gran variedad de métodos de 14

26 Introducción modificación de electrodos basados en diferentes procedimientos: adsorción, recubrimiento con polímeros o formación de enlace covalente. Adsorción La adsorción puede estar basada en interacciones físicas (fisisorción) o químicas (quimisorción) y puede realizarse directamente depositando el material disuelto y evaporando el disolvente o ser asistida mediante la aplicación de un potencial. Por ejemplo, las moléculas que presentan anillos aromáticos con múltiples enlaces π deslocalizados, como las quinonas [Tse, 1978; Revenga-Parra, 2005], tienden a adsorberse físicamente (fisisorción) sobre electrodos muy hidrofóbicos como los de carbono. En el caso de la adsorción química, el ejemplo más conocido es la unión de tioles sobre superficies metálicas, especialmente, el oro, que permite obtener superficies muy ordenadas, compactas y estables [Darder, 1999]. Recubrimiento con polímeros El recubrimiento de la superficie del electrodo con películas poliméricas se puede obtener mediante la deposición o precipitación electroquímica de un polímero ya formado en disolución o, más habitualmente, por polimerización electroquímica. Este procedimiento permite controlar el número de capas del polímero conductor formado mediante la regulación del potencial o de la intensidad aplicados [Adhikari, 2004]. La principal ventaja de la modificación de electrodos por recubrimiento con polímeros es el poder formar de manera sencilla una capa tridimensional en la superficie del electrodo que permita la inclusión de (bio)moléculas, lo que es de gran interés para el desarrollo de aplicaciones (bio)sensoras [Nambiar, 2011]. Formación de un enlace covalente La modificación mediante enlace covalente se consigue a través de la formación de un enlace entre grupos funcionales presentes en el material modificador con otros existentes en la superficie del electrodo. Por tanto, este método requiere previamente la generación de grupos funcionales sobre la superficie del electrodo mediante tratamientos físico-químicos o mediante la derivatización con determinadas moléculas para, posteriormente, establecer el enlace covalente a través de reacciones químicas. 15

27 Introducción Este tipo de modificación presenta ciertas ventajas sobre la modificación por adsorción o por recubrimiento con polímeros tales como que permite obtener superficies modificadas estables a la vez que mantiene un control sobre la estructura y propiedades de la capa modificadora. Sin embargo, el proceso de formación de grupos funcionales en el electrodo suele implicar el uso de condiciones experimentales muy agresivas, como la utilización de ácidos fuertes [Fitzer, 1987], de plasma [Hoffman, 1991] o la aplicación de potenciales extremos [Kepley, 1988], que pueden afectar irreversiblemente la superficie del electrodo, lo que limita la aplicabilidad de este tipo de modificación. Por este motivo, existe un gran interés en el desarrollo de procedimientos que permitan la modificación covalente de la superficie de manera sencilla, con bajo coste y alto rendimiento con el fin de obtener dispositivos que presenten nuevas y mejores propiedades. En este sentido, el procedimiento de injerto es una metodología muy prometedora, que consiste en la formación de un enlace covalente entre el material modificador y la superficie el electrodo. La formación de un enlace covalente da lugar a una modificación estable y robusta, capaz de soportar tratamientos agresivos, como sonicación prolongada, temperaturas elevadas [Allongue, 1997] o la aplicación de potenciales altos [D Amour, 2003]. Este procedimiento se ha utilizado para modificar diferentes superficies con el objeto de incorporar nuevas funcionalidades a los materiales, entre las que destacan la biocompatibilidad [Elbert, 1996], el aumento de la hidrofilicidad [Wavhal, 2002], evitar el envenenamiento de superficies catalizadoras [Li, 2015a] o la protección contra la corrosión [Combellas, 2005]. Dependiendo del fundamento físico-químico empleado para iniciar el proceso de injerto, se puede distinguir entre quimioinjerto, si es una reacción química [Piletsky, 2000]; termoinjerto, si se trata de radiación térmica [Jiang, 2008]; fotoinjerto, en el caso de radiación UV [Renaudie, 2007]; o electroinjerto, cuando se produce por la aplicación de un potencial eléctrico [Belanger, 2011]. De todos ellos, el procedimiento de electroinjerto despierta un gran interés como método de modificación de diferentes materiales debido a que permite obtener un gran control sobre la misma utilizando para ello una instrumentación sencilla y de bajo coste. 16

28 Introducción I Modificación de electrodos mediante electroinjerto de sales de diazonio El electroinjerto se puede definir como un proceso mediante el cual se establece un enlace covalente entre un material orgánico y la superficie de un material conductor, a través de la aplicación de un potencial eléctrico, que provoca la activación de determinados grupos funcionales del material a injertar. Por tanto, el proceso de electroinjerto se basa en una transferencia de electrones entre la superficie del material y el modificador, que lleva en su estructura grupos funcionales susceptibles de ser sometidos a este proceso. De esta manera, se produce una reacción que genera un radical o un carbocatión capaces de formar el enlace covalente entre la superficie del material conductor y el agente modificador. Dependiendo del grupo funcional involucrado el electroinjerto puede llevarse a cabo mediante oxidación o reducción. Entre los grupos funcionales que pueden someterse al proceso de electroinjerto mediante oxidación se encuentran los reactivos de Grignard (RMgX) [Fellah, 2002; Fellah, 2006], los carboxilatos [Brooksby, 2005], las aminas [Adenier, 2004] y los alcoholes [Maeda, 1994]. En cuanto al electroinjerto mediante reducción, los grupos susceptibles son los haluros de alquilo [Andrieux, 1986], los monómeros vinílicos [Voccia, 2006] y las sales de diazonio [Delamar, 1992]. Estas últimas son muy utilizadas debido a su facilidad de preparación, su elevada disponibilidad y su gran reactividad. Las sales de diazonio son una familia de compuestos cuya estructura presenta un grupo diazonio (NΞN + ), que se genera mediante reacción de diazotación entre una amina aromática primaria y el nitrito sódico, que es el agente causante de la diazotación. La reacción de diazotación fue descubierta en 1858 por Peter Griess mientras estudiaba la reacción del ácido picrámico con el ácido nitroso [Griess, 1858]. Como se muestra en el esquema de la figura I.1, la reacción se inicia con la protonación en medio ácido del grupo nitroso, que, a continuación, pierde agua para formar el catión nitrosonio. La reacción de diazotación sucede a través del ataque nucleófilo de la amina aromática sobre el catión nitrosonio, generando una N-nitrosoamina [Vollhardt, 1999]. A continuación, la transferencia de un protón al 17

29 : : : : : : Introducción oxígeno forma un grupo hidroxilo y un doble enlace N-N. Finalmente, la protonación del grupo hidroxilo, seguida de pérdida de agua, produce el catión diazonio. O - N O 2H + + H 2 O N O -H 2 O O N + : H O N + : + H 2 N O : O H H H N + N + - H 3 O O N H N : O N H N + +- H 3 O H H O + N O N H N H N + + -H 2 O : H O N N + +- H 3 O H O : : N N + - H 3 O H H O + N N :N + N N N + N - N + + N - N H 2 O Fig. I.1. Esquema del mecanismo de la reacción de diazotación. Las sales de arildiazonio son estables a bajas temperaturas, a diferencia de las sales de diazonio alifáticas, como consecuencia de la estabilización de la carga por efecto de resonancia a lo largo del anillo aromático [Moffat, 1978]. Además, deben mantenerse en condiciones de oscuridad, ya que la presencia de luz puede provocar su descomposición [Galli, 1988]. En la descomposición de las sales de diazonio se produce la liberación de una molécula de nitrógeno, generando cationes o radicales arilo muy reactivos, lo que supone que las sales de diazonio presenten una alta reactividad. Por ello, se utilizan como intermedios de reacción en síntesis orgánica en la sustitución de anillos aromáticos para formar fenoles, haluros y nitrilos, entre otros [Vollhardt, 1999]. Además, el grupo diazonio es un importante atractor de electrones [Lewis, 1959]. El electroinjerto de sales de diazonio es uno de los métodos más habituales de modificación de electrodos. Esta es la razón por la que en este trabajo se ha utilizado 18

30 Introducción esta reacción para llevar a cabo la modificación de superficies electródicas para su aplicación en el desarrollo de sensores electroquímicos. El electroinjerto de las sales de diazonio sucede a través de la transferencia de un electrón desde el electrodo a la molécula diazotada, provocando la reducción del grupo diazonio y liberando una molécula de nitrógeno, a la vez que se genera un radical arilo. Este radical se une de forma covalente a la superficie del electrodo, como se muestra en el esquema de la figura I.2. N 2 N 2 + e - Fig. I.2. Esquema del mecanismo de electroinjerto de la sal de diazonio. Delamar, Hitmi, Pinson y Savéant describieron por primera vez en 1992 el electroinjerto de las sales de diazonio sobre electrodos de carbón vítreo [Delamar, 1992], concretamente el electroinjerto de 4-nitrobencenodiazonio. Desde entonces, esta metodología se ha aplicado para numerosas sales de diazonio sobre una gran variedad de superficies electródicas, tales como diferentes materiales de carbono (carbón vítreo [Downard, 2000], grafito pirolítico altamente ordenado [Allongue, 1997], grafeno [Lomeda, 2008], nanotubos de carbono [Strano, 2003] o diamante [Lud, 2006]), metales nobles, como oro y platino, y otros metales, como cobalto, hierro, cobre, zinc, níquel y aluminio [Hurley, 2004; Bernard, 2003], semiconductores (silicio [Allongue, 2003], arseniuro de galio [Stewart, 2004] u óxido de titanio [Merson, 2004]), u óxidos conductores, como el óxido de indio y estaño (ITO) [Maldonado, 2006]. Una de las limitaciones que presenta la modificación por electroinjerto de las sales de diazonio se deriva precisamente de la gran reactividad del radical arilo, que puede provocar la formación de multicapas del material modificador sobre la superficie del electrodo, debido a la reacción del radical arilo electrogenerado sobre las posiciones libres del anillo aromático de la molécula previamente electroinjertada, en una 19

31 Introducción reacción conocida como sustitución aromática homolítica [Kariuki, 1999]. De esta manera, el espesor de la película electroinjertada puede variar entre una monocapa y decenas de nanómetros [Ceccato, 2011]. Sin embargo, a medida que aumenta el número de capas en la película electroinjertada, la conductividad a través de ella disminuye [Kariuki, 2001], lo que provoca que el número de radicales arilo electrogenerados sea cada vez menor y que finalmente se produzca la auto-inhibición del crecimiento de la película. Mediante el control de los parámetros experimentales, tales como el potencial aplicado y el tiempo de aplicación de ese potencial o el número de barridos, se evita el crecimiento descontrolado de la película y se puede regular la formación de multicapas de material [Pinson, 2005]. Esto conduce a un control de las propiedades del electrodo modificado, como la conductividad, la reactividad o la estabilidad. La modificación de electrodos mediante electroinjerto de sales de diazonio, además de permitir obtener un buen control sobre la misma, requiere una instrumentación sencilla y económica, por lo que se ha utilizado para numerosas aplicaciones, por ejemplo, protección frente a la corrosión [Chaussé, 2002], desarrollo de sensores químicos [Flavel, 2010], unión de biomoléculas [Lynam, 2007], desarrollo de biosensores [Liu, 2006] o en microelectrónica [Aswal, 2009], entre otras. I.2. Electrodos modificados con nanomateriales Desde hace unos años existe un gran interés en el diseño y la utilización de nuevos materiales en el desarrollo científico y tecnológico. En este sentido, los materiales nanoestructurados o nanomateriales resultan muy atractivos, ya que presentan unas propiedades fisicoquímicas diferentes a las de los materiales macroscópicos de la misma composición. Los nanomateriales se caracterizan por poseer al menos una de sus dimensiones en la escala nanométrica, es decir, entre 1 y 100 nanómetros. En función del número de dimensiones que se encuentren en dicha escala, los nanomateriales se pueden clasificar en [Pokropivny, 2007]: 20

32 Introducción 0D: todas las dimensiones se encuentran en el intervalo nanométrico. En esta categoría se encuentran las nanopartículas, nanopuntos, puntos cuánticos, fullerenos, nanodiamante 1D: una de las dimensiones supera el límite establecido de 100 nm y abandona la nanoescala. Pertenecen a esta categoría los nanotubos, nanofibras, filamentos 2D: solamente una de las dimensiones se encuentra en la escala nanométrica. Es el caso del grafeno, monocapas, películas delgadas 3D: son nanoestructuras formadas por nanomateriales pertenecientes a las categorías anteriores, como policristales, compósitos, nanomateriales dispersos en una matriz Existen dos factores fundamentales que provocan que los nanomateriales se comporten de manera diferente a los materiales macroscópicos: el efecto de superficie y el efecto cuántico de tamaño [Roduner, 2006]. El primer efecto se produce debido a que la proporción de átomos en la superficie es mucho mayor en los materiales nanométricos que en los materiales a escalas mayores. El segundo, en cambio, se debe a que, a medida que disminuye el tamaño en un material, la separación entre los niveles discretos de energía es mayor y se producen discontinuidades. Estos factores afectan a la reactividad química de los materiales, al igual que a sus propiedades mecánicas, ópticas, eléctricas y magnéticas. Por otro lado, las propiedades únicas de los nanomateriales no solo dependen de su composición y tamaño y forma, sino también, en gran medida, de los grupos funcionales presentes en su superficie. Estos grupos funcionales definen su reactividad, estabilidad física y química, estructura y, por tanto, sus posibles aplicaciones. La modificación de la superficie de los nanomateriales permite incorporar nuevas funcionalidades con el objeto de mejorar su estabilidad, biocompatibilidad, selectividad o sus propiedades ópticas, eléctricas o catalíticas y ampliar sus aplicaciones [Wang, 2011a; Hirsch, 2005]. El proceso de modificación de la superficie se conoce como funcionalización química y consiste en la unión de diferentes materiales orgánicos o inorgánicos a través de enlaces covalentes o uniones no covalentes, como enlaces de hidrógeno o interacciones electrostáticas o de van der Waals [Li, 2011c]. Hasta ahora, se ha diseñado un gran número de 21

33 Introducción nanomateriales funcionalizados con componentes orgánicos, inorgánicos e incluso biológicos, cuyas nuevas propiedades los capacitan para su aplicación en diferentes campos [Alex, 2015; Thakur, 2016]. Para ello, se han descrito numerosos métodos de incorporación de estas funcionalidades a la superficie de los nanomateriales. Asimismo, es interesante destacar que mediante el procedimiento sintético adecuado es posible introducir grupos funcionales en el nanomaterial durante su síntesis. De esta manera se reduce el número de etapas necesarias para conseguir las funcionalidades deseadas en el material, lo que permite obtener nanomateriales funcionalizados para diferentes aplicaciones de manera más rápida, sencilla y económica. Con este propósito, en este trabajo se ha utilizado la molécula N,N-bis(3,4- dihidroxibenciliden)-1,2-diaminobenceno (figura I.3), con un doble papel como agente reductor y funcionalizador en la síntesis de nanopartículas de oro funcionalizadas y de grafeno modificado químicamente. También se ha utilizado como mediador redox en el desarrollo de sensores y biosensores. Este compuesto pertenece a la familia de las bases de Schiff, cuya característica principal es la presencia de un grupo azometino, que se forma por la condensación de aminas primarias con compuestos carbonílicos. Dentro de esta familia, los productos de la condensación del salicilaldehído con la orto-fenilendiamina, cuya nomenclatura IUPAC es N,N -ortofenilenebis- (salicilaldimina), reciben el nombre genérico de salofen. Por tanto, este ligando, derivado de la reacción de 3,4-dihidroxibenzaldehído con la o-fenilendiamina, recibe el nombre de 3,4-dihidroxisalofen o, abreviado, 3,4-DHS. N N OH OH OH OH Fig. I.3. Estructura del N,N-bis(3,4-dihidroxibenciliden)-1,2-diaminobenceno o 3,4-DHS. 22

34 Introducción Este ligando polihidroxilado posee en su estructura átomos donadores, que le permiten formar enlaces de coordinación con metales a través de los nitrógenos de los grupos imina y los oxígenos de los grupos hidroxilo. Sin embargo, la posición de los grupos hidroxilo en relación a los átomos de nitrógeno limita su capacidad para actuar como ligando tetradentado, a diferencia de sus isómeros con un grupo -OH en la posición α [Revenga-Parra, 2008]. Además, está formada por tres anillos aromáticos, lo que le aporta una cierta planaridad y capacidad de adsorción a través de interacciones con la nube π. Por otro lado, la presencia en su estructura de dos grupos orto-hidroquinona le otorga propiedades reductoras suaves (el potencial de reducción de la o-quinona es V) [Conant, 1924]. Además, estos mismos grupos son los responsables de sus propiedades catalíticas. Concretamente, el 3,4-DHS adsorbido sobre electrodos de carbón vítreo presenta actividad electrocatalítica frente a la oxidación de hidrazina [Revenga-Parra, 2005]. También se ha publicado un estudio de las propiedades ópticas y electroquímicas resultantes tras su interacción con nanopartículas de oro recubiertas de citrato [Abad, 2011]. En ese estudio se demuestra que el 3,4-DHS es capaz de desplazar al citrato en la superficie de las nanopartículas, formando un conjugado 3,4-DHS/nanopartícula de oro que, depositado sobre un electrodo serigrafiado de carbono, muestra propiedades electrocatalíticas frente a la oxidación de NADH. En cuanto a sus aplicaciones en biociencia, el 3,4-DHS se ha empleado en diferentes estudios de interacción con ADN [Yuan, 2013; Azani, 2010] y se ha demostrado que puede ser utilizado como indicador electroquímico del proceso de hibridación en el desarrollo de biosensores de ADN [Revenga-Parra, 2007]. Por todo ello, se puede afirmar que la combinación de las propiedades de esta molécula la convierten en un candidato ideal para su uso como agente funcionalizador de nanomateriales con propiedades electrocatalíticas. El uso de los nanomateriales funcionalizados o no como modificadores de electrodos presenta una serie de ventajas que resultan de gran utilidad en el desarrollo de sensores y biosensores electroquímicos. Estos se pueden utilizar de distintas formas, desde para la modificación directa de la superficie electródica hasta la formación de 23

35 Introducción conjugados o bioconjugados con moléculas o biomoléculas. Esto último puede lograrse ya que las biomoléculas y los nanomateriales poseen un tamaño en el mismo intervalo, por lo que se pueden formar híbridos con propiedades sinérgicas. La nanoestructuración de electrodos permite obtener una mejora en la selectividad, un incremento de la sensibilidad y un aumento en la repetitividad y en la estabilidad [Zhang, 2016]. Esto se consigue gracias a que los materiales, debido a su relación entre área y volumen, proporcionan una mayor superficie específica, lo que permite un mayor contacto entre el analito y el electrodo. Además, los electrodos modificados con nanomateriales pueden comportarse como conjuntos de nanoelectrodos, aumentando la sensibilidad. Adicionalmente, la presencia de los nanomateriales sobre el electrodo puede aumentar la cinética de transferencia de carga, proporcionando tiempos de repuesta más cortos y al mismo tiempo, los materiales nanoestructurados pueden actuar como catalizadores altamente selectivos debido a sus propiedades electrónicas únicas [Wang, 2005]. Estas características de los electrodos nanoestructurados son de gran utilidad en el desarrollo de sistemas sensores y biosensores. Cuando, además, estos nanomateriales se encuentran funcionalizados es posible lograr, a través de los grupos funcionales presentes en su superficie, la inmovilización de determinadas especies, que pueden ser analitos o elementos de reconocimiento biológico. De esta manera se mejora la selectividad, a la vez que se minimiza la acumulación de impurezas sobre el electrodo, mejorando la repetitividad y la estabilidad. Además, las nuevas funcionalidades incorporadas la superficie del electrodo a través de la inmovilización de los nanomateriales funcionalizados pueden actuar como electrocatalizadores selectivos, lo que supone otra ventaja adicional, especialmente en el desarrollo de sistemas de detección electrocatalíticos. En este trabajo se han utilizado diferentes nanomateriales para el desarrollo de (bio)sensores electroquímicos. En concreto, se han utilizado nanopartículas de oro y nanomateriales de la familia del carbono, más concretamente, nanotubos de carbono, grafeno y nanopuntos de carbono. 24

36 Introducción I.2.1 Nanopartículas de oro Las nanopartículas de metales nobles, especialmente las de oro, son unos materiales que despiertan un gran interés, ya que presentan unas propiedades ópticas, eléctricas, magnéticas y catalíticas muy especiales. Se definen como agrupaciones aisladas de átomos de tamaño inferior a 100 nm, rodeados por una capa estabilizante que evita su agregación. Las propiedades de las nanopartículas de oro (AuNPs) dependen en gran medida de su tamaño, forma y superficie química, que, a su vez, están definidos por las condiciones experimentales utilizadas en su síntesis. Las AuNPs presentan una gran relación entre superficie y volumen, son conductoras de la electricidad, muestran propiedades catalíticas hacia la oxidación o reducción de diferentes moléculas [Daniel, 2004], pueden actuar como mediadores en procesos electroquímicos [Wang, 2004a] y presentan una excelente biocompatibilidad y baja toxicidad [Khlebtsov, 2011; Murphy, 2008], que las convierten en ideales para su aplicación en biociencia. Además de estas, las propiedades más destacables de las AuNPs son sus propiedades ópticas, entre las que es importante resaltar su capacidad para amortiguar la emisión de fluoróforos que se encuentren en contacto con ellas y, sobre todo, su propiedad más característica, que es la resonancia de plasmón superficial (SPR) [Yeh, 2012]. La resonancia de plasmón superficial consiste en una oscilación colectiva de los electrones de la banda de conducción de las nanopartículas con una cierta frecuencia al ser excitadas mediante luz [Cao, 2004]. Esto se basa en que el campo electromagnético alterno de la luz incidente interacciona con las partículas, induciendo una polarización en la superficie de las mismas debida al desplazamiento de los electrones libres con respecto a la red de cationes que las forman. En este proceso, se genera una diferencia neta de carga sobre los extremos de las partículas, que actúa como una fuerza restauradora, creando una oscilación dipolar de electrones con una cierta frecuencia (figura I.4). 25

37 Campo electromagnético Introducción Fig. I.4. Representación esquemática del efecto de resonancia del plasmón superficial. Este fenómeno provoca que las dispersiones acuosas de nanopartículas de metales nobles presenten una banda de absorción en la zona del visible, en el caso del oro, entre 500 y 550 nm [Jain, 2006], denominada banda de plasmón superficial, que origina que las dispersiones de oro coloidal muestren un color característico, que puede ser marrón, naranja, rojo o morado. La posición de la banda y, por tanto, el color de la dispersión dependen del tamaño -de hecho, esta banda no es apreciable tanto en nanopartículas de diámetro inferior a 2 nm como en el material a escala macroscópica-, aunque también de la forma de las nanopartículas, del disolvente, de la concentración, de la capa que las rodea, de la carga del núcleo y de la proximidad a otras partículas [Yeh, 2012]. La agregación de las nanopartículas provoca un desplazamiento de la banda de plasmón superficial a longitudes de onda mayores debido al acoplamiento de plasmones superficiales entre partículas vecinas [Su, 2003] y se observa un cambio en el color de la dispersión hacia tonos más azules. Al igual que otros nanomateriales, su potencial aplicación en diferentes áreas se ve aumentada al funcionalizarlas para capacitarlas para una aplicación específica. En este sentido, además de las extraordinarias propiedades de las nanopartículas de oro, la facilidad para su funcionalización química y bioquímica, han llevado a su aplicación en diversos campos. Así se ha descrito su uso como catalizadores [Remediakis, 2005; Grzybowska-Świerkosz, 2006], como marcadores en microscopía electrónica [Thiberge, 2004] o como marcadores bioquímicos para la detección o 26

38 Introducción reconocimiento de biomoléculas [Dequaire, 2000]. En concreto, sus excelentes propiedades conductoras y catalíticas las convierten en un material idóneo para su aplicación en (bio)sensores electroquímicos. I Síntesis de nanopartículas de oro Se ha desarrollado una gran variedad de métodos para producir nanopartículas metálicas. Para la generación de nanomateriales en la nanoescala existen dos estrategias generales: top-down o físicos y bottom-up o químicos. Los métodos físicos consisten en la eliminación de parte de un sustrato de oro utilizado como material de partida, de manera que lo que quede sean las nanoestructuras buscadas, mientras que los métodos químicos se basan en la unión de átomos, generalmente producidos por la reducción de iones, para generar las nanoestructuras. Los métodos físicos, tales como fotolitografía, litografía de haz de electrones [Hu, 2010] o ablación láser [Huang, 2006], son caros debido a la cantidad de material eliminado, a la vez que requieren de instrumentación costosa. Por esta razón, en la síntesis de nanopartículas de oro se utilizan fundamentalmente métodos químicos. Los métodos químicos están basados en la reducción de iones de oro a átomos, que actúan como núcleos a los que se van incorporando nuevos átomos, provocando el crecimiento de las partículas. Este proceso se lleva a cabo en presencia de un agente estabilizante, que se adsorbe sobre la superficie e inhibe la agregación de las nanopartículas, ya que estas en disolución tienen tendencia a agregarse debido a interacciones de van der Waals [Sifontes, 2010]. El método más habitual de síntesis de nanopartículas esféricas es el desarrollado por Turkevich [Turkevich, 1951], que consiste en la reducción de una sal de oro (HAuCl 4 ) con ácido cítrico en agua en ebullición. En este caso, los iones de citrato actúan como agente estabilizante a la vez que como agente reductor. El método fue optimizado por Frens [Frens, 1973], quien describió que, variando la proporción entre oro y citrato, se podían obtener nanopartículas relativamente estables de diferente tamaño, entre 10 y 20 nm. Este método se utiliza para conseguir nanopartículas rodeadas por una capa lábil, que permite el intercambio de ligandos para obtener nanopartículas funcionalizadas. 27

39 Introducción Otro método de síntesis es el descrito por Brust y Schiffin en el que se obtienen nanopartículas de oro estabilizadas por tioles mediante una reducción en dos fases utilizando bromuro de tetraoctilamonio (TOAB) como el agente de transferencia de fase y borohidruro sódico (NaBH 4 ) como agente reductor en presencia de dodecanotiol [Brust, 1994]. Este método permite obtener nanopartículas más pequeñas que el método de Turkevich-Frens, entre 1.5 y 5 nm, variando las condiciones de reacción. Además, se han descrito otros métodos de síntesis, como la síntesis fotoquímica [Sau, 2001; Mallick, 2001], sonoquímica [Chen, 2001a], radiolisis [Henglein, 1998; Dawson, 2000], termolisis [Nakamoto, 2002] o biosíntesis, utilizando extractos de plantas [Mittal, 2013] u hongos [Shankar, 2003]. Cualquiera que sea el método utilizado para la síntesis de las nanopartículas, el objetivo es conseguir que sean monodispersas, con idéntica morfología, composición química y estructura cristalina y que se encuentren como estructuras aisladas, es decir, que no existan fenómenos de agregación. I Funcionalización de nanopartículas de oro Las nanopartículas de oro son inestables en disolución, por lo que es necesario modificar su superficie con un agente estabilizante que evite su agregación. Los mecanismos más utilizados para la estabilización de las nanopartículas son la estabilización de carga mediante la adsorción de moléculas cargadas, como el citrato [Alex, 2015] y la estabilización estérica por recubrimiento de la superficie de las nanopartículas con moléculas grandes, como polímeros [Corbierre, 2004], macromoléculas [Thanh, 2010], dendrímeros [Kim, 2004] o surfactantes [Edgar, 2012]. Por otro lado, la funcionalización de la superficie de las nanopartículas con determinados compuestos o grupos funcionales puede capacitarlas para una aplicación específica. En algunos casos, el agente estabilizante contiene los grupos funcionales adecuados para una función específica y en otros casos, es necesario incorporar nuevas moléculas a la superficie de la nanopartícula o al agente estabilizante. Por tanto, se puede decir que la funcionalización de las nanopartículas 28

40 Introducción se suele llevar a cabo mediante dos estrategias: la modificación de la superficie de nanopartículas previamente sintetizadas o la incorporación de un agente modificador en la síntesis del oro coloidal. La primera generalmente se ha utilizado a partir de nanopartículas sintetizadas mediante el método de Turkevich-Frens [Frens, 1973], en el que las nanopartículas de oro sintetizadas se encuentran estabilizadas por moléculas de citrato. El citrato es un ligando lábil, que puede ser desplazado por otros compuestos mediante reacciones de intercambio de ligandos. Los compuestos más habitualmente empleados para este fin son aquellos que contienen un grupo tiol en su estructura debido a la afinidad que presenta este grupo por el oro. A través de la unión tiol-oro se pueden unir fácilmente una gran variedad de moléculas [Love, 2005; Zaluzhna, 2012; Toikkanen, 2008] y biomoléculas [Cobley, 2011]. Además de la quimisorción de tioles, se ha utilizado también la química de la coordinación para la incorporación de ligandos al oro en la funcionalización de nanopartículas a través de otros grupos funcionales, tales como grupos oxigenados [Jena, 2007], grupos nitrogenados [Moores, 2004; Griffin, 2007] o grupos fosforados [Pettibone, 2011]. Mediante el uso de ligandos bifuncionales también es posible incorporar a la superficie de las nanopartículas una enorme variedad de compuestos. La segunda estrategia consiste la obtención de nanopartículas funcionalizadas en el propio proceso de síntesis, eliminando así etapas de reacción para obtener el producto deseado, que pueden ser lentas y pesadas y pueden influir tanto en el tamaño como en la forma de las nanopartículas. I Síntesis de nanopartículas de oro funcionalizadas Como ya se ha comentado, la síntesis de nanopartículas de oro se suele realizar en presencia de un agente estabilizante. La elección del agente estabilizante adecuado puede resultar en la formación de nanopartículas ya funcionalizadas, disponibles para su posterior aplicación. En este caso, durante la reducción de la sal de oro para la formación de las nanopartículas, el agente funcionalizador se une a la superficie de las nanopartículas, proporcionando, además, estabilidad y control sobre su tamaño [Zhou, 2009b]. 29

41 Introducción Los métodos de síntesis de nanopartículas de oro funcionalizadas más utilizados están basados en modificaciones del procedimiento sintético descrito por Brust y Schiffrin [Brust, 1994; Brust, 1995]. Por medio de este método se producen nanopartículas de oro estabilizadas por una monocapa orgánica de tioles. Además, se han descrito otros métodos de síntesis de nanopartículas funcionalizadas con diferentes compuestos unidos a la superficie del oro a través de grupos tiol [Chen, 1999; Aguila, 2000; Cliffel, 2000; Templeton, 2000a; Templeton, 2000b; Kometani, 2001; Shon, 2001]. También se encuentran en la bibliografía ejemplos de síntesis de nanopartículas de oro funcionalizadas con moléculas orgánicas cuyas propiedades combinadas permiten su aplicación en diferentes áreas. Así, se ha descrito el uso de crocina [Hoshyar, 2016] o de quercetina [Das, 2013] en la síntesis de nanopartículas funcionalizadas para su aplicación en quimioterapia; de azacriptando [Lee, 2007] o ácido tánico [Aswathy Aromal, 2012], con aplicación en electrocatálisis; o ácido 3-aminofenilborónico [Ma, 2005] o ácido 4-mercaptofenilborónico [Chen, 2017], con aplicación en sensores ópticos de glucosa y dopamina, respectivamente. En todos los casos, es el propio agente modificador el que actúa como reductor en la síntesis de las nanopartículas. I.2.2 Grafeno El grafeno es un material bidimensional formado por una monocapa de átomos de carbono con hibridación sp2 dispuestos en forma de hexágonos, como en un panal de abeja [Geim, 2007]. Constituye la unidad básica estructural de otros materiales de carbono, como el grafito, los nanotubos de carbono o los fullerenos [Allen, 2010]. Por este motivo ya había sido estudiado antes de que Geim y Novoselov consiguieran aislar una capa de grafeno por primera vez en 2004 [Geim, 2007]. Las excepcionales propiedades del grafeno se deben a los fuertes enlaces entre carbonos sp 2 y a la conjugación del sistema π de su estructura. Gracias a ello, presenta una alta conductividad eléctrica [Stankovich, 2007] y térmica [Ghosh, 2008]. Presenta, además, unas excelentes propiedades mecánicas, con elevados módulo de Young y resistencia a la tracción [Lee, 2008], por lo que es un material muy flexible y resistente. 30

42 Introducción Además, muestra una gran estabilidad térmica [Wu, 2009]. Una de sus propiedades más llamativas es su transparencia óptica. Una monocapa de grafeno muestra una transmitancia del 97.7% [Nair, 2008], lo que hace que sea un material prometedor para la fabricación de dispositivos electrónicos, tales como pantallas. Además, presenta una elevada área superficial [Stoller, 2008], lo que puede ser interesante de cara al desarrollo de sensores, ya que permite la inmovilización de gran cantidad de moléculas sobre su superficie. En cuanto a su reactividad, cabe destacar que el grafeno es un material poco reactivo en el plano basal, mientras que la presencia de insaturaciones en los extremos hace que la reactividad sea muy alta, es decir, es químicamente anisótropo [Banks, 2005]. Las extraordinarias propiedades del grafeno lo convierten en un material muy interesante para un gran abanico de aplicaciones, con un gran potencial para su aplicación en sensores y biosensores electroquímicos debido a que presenta unas excelentes propiedades electroquímicas, tales como una amplia ventana de potencial, una baja resistencia a la transferencia de carga, una excelente actividad electrocatalítica [Gao, 2015] o la capacidad de evitar el envenenamiento de los electrodos [Lin, 2009]. I Síntesis de grafeno El método utilizado por Geim y Novoselov para el aislamiento de una lámina de grafeno mediante la exfoliación mecánica de grafito con una cinta adhesiva [Geim, 2007] puede generar grafeno de una alta calidad, sin embargo no es adecuado para la producción a gran escala. Por este motivo, se han desarrollado diferentes métodos para la síntesis de grafeno, tales como crecimiento epitaxial [Sutter, 2008], deposición química en fase vapor (CVD) de un hidrocarburo [Mattevi, 2011], exfoliación en fase líquida [Hernandez, 2008], exfoliación química [Dreyer, 2010] y síntesis orgánica [Wu, 2007]. Entre estos métodos, la exfoliación química atrae un gran interés, ya que es un método sencillo y no requiere una equipación especial. Este proceso consiste en la oxidación de grafito a óxido de grafito, seguida de la exfoliación del óxido de grafito en láminas individuales de óxido de grafeno (GO) y, por último, la reducción del óxido de grafeno a grafeno reducido (rgo), que presenta una menor proporción de oxígeno [Bai, 2011]. El método más habitual de síntesis de óxido de grafeno es el desarrollado 31

43 Introducción por Hummers [Hummers, 1958; Xu, 2008], que consiste en un tratamiento oxidante del grafito con KMnO 4 y NaNO 3 en H 2 SO 4 para formar óxido de grafito y la posterior exfoliación de GO en agua mediante la aplicación de ultrasonidos. El GO es una lámina aislada de óxido de grafito. Su estructura (figura I.5B) consta de una parte hidrofóbica, que es la estructura básica del grafeno (figura I.5A), y de una parte hidrofílica formada por grupos oxigenados, como hidroxilos, epóxidos, carbonilos y carboxilos [Gao, 2009]. Estos grupos funcionales generados en el proceso de oxidación se encuentran tanto en los bordes como en el plano basal y facilitan la solubilidad del óxido de grafeno en agua. Además, la presencia de los grupos funcionales hace que el GO pueda ser funcionalizado por reacción con diferentes compuestos con el objeto de para mejorar sus propiedades y obtener un material versátil para una gran variedad de aplicaciones [Park, 2009]. A B Fig. I.5. Estructura de (A) grafeno y (B) óxido de grafeno. Por otra parte, la oxidación del grafito provoca la ruptura parcial de la conjugación π, lo que produce una pérdida de la conductividad y hace que el GO pueda ser semiconductor o aislante dependiendo del grado de oxidación y de la proporción entre carbonos de tipo sp 2 y sp 3. Esto limita la aplicabilidad del GO en el desarrollo de sensores electroquímicos, por lo que se hace necesario recuperar la conductividad eléctrica. Una manera de conseguirlo es restaurando la red π de los carbonos aromáticos a través de la reducción del GO [Pei, 2012]. Mediante la reducción de GO se puede obtener un material con una estructura similar al grafeno, que sin embargo, presenta grupos funcionales en su superficie. Es decir, mediante la reducción de GO 32

44 Introducción es posible obtener directamente grafeno funcionalizado químicamente. De esta manera se puede obtener un material conductor que presente las funcionalidades deseadas en una sola etapa de reacción, de forma rápida y sencilla. I Preparación de grafeno modificado químicamente La reducción de GO produce un material similar al grafeno, pero con propiedades ligeramente distintas, en el que se han eliminado gran parte de los grupos oxigenados y se ha reestablecido parcialmente la conjugación π, aunque existen grupos funcionales residuales y defectos que alteran la estructura plana del carbono [Pei, 2012]. Este material (rgo) se conoce con varios nombres, como grafeno reducido, óxido de grafeno reducido, grafeno funcionalizado, grafeno modificado químicamente o grafeno convertido químicamente [Eda, 2010]. La reducción de GO para recuperar parcialmente las propiedades del grafeno es un proceso de gran importancia, ya que según el método de reducción se puede obtener grafeno reducido con diferentes propiedades y, por lo tanto, con distintas posibles aplicaciones. Se han descrito diferentes métodos para conseguir la reducción del GO y producir rgo, que se pueden agrupar en métodos térmicos, fotocatalíticos, electroquímicos y químicos. La reducción térmica se basa en la descomposición en gases de los grupos funcionales oxigenados presentes en el GO [Schniepp, 2006]. Puede aplicarse sobre láminas previamente exfoliadas [Zhao, 2010] o puede utilizarse como un método de síntesis de rgo directamente a partir de óxido de grafito, ya que el aumento de presión provocado por esos gases puede producir la exfoliación de las láminas del grafito, además de reducir los grupos funcionales [McAllister, 2007]. Dentro de esta categoría se puede incluir también el método solvotermal, que consiste en elevar la temperatura muy por encima del punto de ebullición por efecto de la presión generada durante el calentamiento en un recipiente sellado [Wang, 2009a]. Además, también se ha descrito el uso de las microondas [Zhu, 2010] y de la irradiación de luz visible [Cote, 2009; Zhang, 2010] como métodos de calentamiento para producir la reducción termal de GO. La luz también es la responsable de la reducción del GO en los métodos fotocatalíticos. Esta, en presencia de catalizadores, puede producir reacciones 33

45 Introducción químicas fotoinducidas que provocan la reducción de los grupos funcionales. Se ha descrito el uso como catalizadores de TiO 2 [Kamat, 1993], ZnO [Williams, 2009] o BiVO 4 [Ng, 2010]. La reducción electroquímica puede llevarse a cabo sobre películas de GO depositadas en la superficie del electrodo [Zhou, 2009a] o directamente sobre una dispersión de GO [Casero, 2013]. Se ha descrito, además, un método para la reducción de GO mediante deposición electroforética [An, 2010]. La reducción mediante el uso de reactivos químicos presenta algunas ventajas sobre los otros métodos descritos. En este caso, la reducción se produce por reacción química entre el GO y el agente reductor. Habitualmente, esta reacción se lleva a cabo a temperatura ambiente o mediante un calentamiento moderado, a diferencia de los métodos térmicos, por lo que no se requiere una equipación especial. Además, la reducción química permite incorporar nuevas funcionalidades sobre la lámina de grafeno reducido resultante, que provienen del reductor utilizado. De esta manera, se puede lograr la reducción de GO y la funcionalización del rgo en una sola etapa. Estos reactivos químicos responsables del proceso de reducción pueden ser agentes reductores fuertes, como hidrazina [Stankovich, 2007] o sus derivados, dimetilhidrazina [Stankovich, 2006] o 4-hidrazinilpiridina [Shin, 2017], borohidruro sódico [Shin, 2009] o ácido yodhídrico [Pei, 2010]. Otros agentes reductores utilizados son el ácido ascórbico [Fernández-Merino, 2010], la hidroquinona [Wang, 2008a], disoluciones concentradas de bases como KOH o NaOH en caliente [Fan, 2008], hidroxilamina [Zhou, 2011], pirogalol [Wang, 2008b] o urea [Lei, 2012]. En muchos de estos métodos de reducción se producen reacciones químicas que son selectivas hacia uno varios grupos funcionales, por tanto, es posible que mediante la utilización de un solo método no sea posible la eliminación de todos los grupos oxigenados. Por ello, algunos autores proponen el uso de una combinación de varios de estos métodos para lograr una reducción más efectiva [Gao, 2009; Eda, 2008]. I.2.3 Nanotubos de carbono Los nanotubos de carbono (CNTs) son cilindros formados por una o varias láminas de grafeno. Estos presentan un diámetro del orden de unos pocos nanómetros, 34

46 Introducción dependiendo del número de capas, sin embargo, en longitud se encuentran en la escala micrométrica [Eatemadi, 2014]. Fueron descubiertos en 1991 por Iijima [Iijima, 1991], abriendo un campo de investigación muy amplio con gran variedad de aplicaciones debido a sus interesantes propiedades, tanto físicas como químicas. Existen diferentes tipos de nanotubos de carbono. Se pueden clasificar atendiendo a dos criterios: el número de capas que lo forman y la forma en la que se enrolla la lámina de grafeno [Eatemadi, 2014]. Así, en función del número de capas se puede distinguir entre nanotubos de pared simple (SWCNTs) o de pared múltiple (MWCNTs). Además, estos últimos pueden estar formados por varios nanotubos de pared simple concéntricos de manera que los de mayor diámetro rodean a los más pequeños, en lo que se conoce como el modelo de muñeca rusa, o pueden estar formados por una sola lámina enrollada sobre sí misma en forma de espiral, en el modelo de pergamino. Por otro lado, atendiendo a la forma en la que se enrolla la lámina de grafeno se puede diferenciar entre zigzag, sillón y quirales (figura I.6). zigzag quiral sillón sillón zigzag sillón sillón quiral zigzag quiral zigzag quiral Fig. I.6. Representación esquemática de la construcción de un nanotubo por enrollamiento de una lámina de grafeno. El potencial de los nanotubos para su aplicación en diferentes campos se debe a sus extraordinarias propiedades, que dependen del tipo de nanotubo y de su longitud. Estos presentan una elevada conductividad eléctrica a través de los anillos de carbonos sp 2 que lo forman. En concreto, los nanotubos de tipo sillón son siempre metálicos, mientras que los de tipo zigzag y quirales pueden ser metálicos, semiconductores o aislantes [Cao, 2003]. Además, los nanotubos muestran una elevada resistencia a la tracción, debido a los enlaces sp 2 entre los átomos de 35

47 Introducción carbono [Eatemadi, 2014] y una gran flexibilidad, lo que permite que puedan doblarse y recuperar la forma sin sufrir cambios estructurales [Iijima, 1996]. Es interesante destacar que los nanotubos de carbono presentan una elevada área superficial, lo que puede permitir la adsorción de moléculas y biomoléculas sobre su superficie. Además, son biocompatibles y, en ausencia de defectos, químicamente inertes. Estas características los hacen muy interesantes de cara a aplicaciones en biociencia. A pesar de todas estas cualidades, el uso de los nanotubos de carbono tiene una limitación importante y es la tendencia a la agregación que presentan debido a interacciones π-π entre los anillos aromáticos, que los mantienen unidos y los hacen insolubles en todos los disolventes y difíciles de dispersar. Para poder utilizar las propiedades especiales de este material, es necesaria su dispersión. Esta se puede conseguir mediante métodos mecánicos, utilizando ultrasonidos, procesos de calandrado [Gojny, 2004], agitación [Sandler, 1999] o extrusión [Villmow, 2008], o mediante funcionalización química de los nanotubos. Uno de los métodos más efectivos es la funcionalización no covalente con surfactantes [Yu, 2007], que disminuyen la tensión superficial, a la vez generan fuerzas electrostáticas repulsivas, previniendo de esta manera la agregación. Estas interesantes propiedades electrónicas, químicas y mecánicas los hacen muy atractivos para diferentes aplicaciones [Eatemadi, 2014; Baughman, 2002], especialmente, para su aplicación en sensores y biosensores electroquímicos, ya que, además, pueden mejorar el proceso de transferencia de carga [Lawal, 2016]. I Síntesis de nanotubos de carbono Los métodos más habituales de síntesis de nanotubos de carbono son: descarga por arco eléctrico, ablación láser y deposición química en fase vapor (CVD) y síntesis en llama. Todos ellos se basan en la vaporización de una fuente de carbono que se condensa en forma de nanoestructuras de carbono. En los dos primeros métodos la fuente de carbono empleada es el grafito. En el método de descarga por arco eléctrico la vaporización se consigue gracias a la aplicación de una corriente [Anazawa, 2002] y en el método de ablación láser, mediante la incidencia de un láser [Muñoz, 2000]. En los métodos de síntesis por deposición química en fase vapor y 36

48 Introducción síntesis en llama se utilizan hidrocarburos como fuente de carbono y catalizadores metálicos para la generación de las nanoestructuras [Hsiou, 2004; Baker, 1972; Vander Wal, 2001]. I.2.4 Nanopuntos de carbono En la familia de los nanomateriales de carbono se encuentran varios miembros pertenecientes a la categoría 0D: fullerenos, nanopuntos de carbono (CNDs), puntos cuánticos de grafeno (GQDs) y nanodiamante [Georgakilas, 2015]. Los fullerenos, CNDs y GQDs son materiales grafíticos y están compuestos principalmente por carbonos sp 2, aunque pueden contener algunos átomos de tipo sp 3 en los bordes o en los defectos, mientras que el nanodiamante está formado por carbonos sp 3 y sp 2 en diferentes proporciones y puede presentar una mezcla de regiones amorfas y grafíticas. Dentro de los nanomateriales de carbono 0D grafíticos, los fullerenos son estructuras esféricas huecas constituidas por átomos de carbono dispuestos en forma de hexágonos y pentágonos, sin embargo, los CNDs y los GQDs son estructuras compactas. Los CNDs y los GQDs son estructuralmente distintos. Los CNDs son nanopartículas quasiesféricas con diámetros entre 2 y 10 nm y pueden tener una estructura cristalina o amorfa [Ray, 2009]. Por el contrario, los GQDs son el producto del corte del grafeno en pequeños trozos entre 2 y 20 nm, por lo que presentan una estructura cristalina [Ponomarenko, 2008]. Además son anisotrópicos, con unas dimensiones laterales mayores que su altura, y pueden tener una o varias capas. Los nanopuntos de carbono fueron descubiertos por casualidad en 2004 durante la purificación mediante electroforesis de nanotubos de carbono [Xu, 2004]. Se los conoce también con el nombre de nanopuntos carbogénicos, debido a su alto contenido en oxígeno [Bourlinos, 2008; Liu, 2011b] o con el de carbono fluorescente, ya que presentan una gran capacidad de emisión fluorescente [Li, 2012]. Precisamente esta propiedad es la razón por la que este material está siendo ampliamente estudiado. Una característica que presenta la fluorescencia de los nanopuntos de carbono es que tanto la intensidad como la longitud de onda de emisión son dependientes de la longitud de onda de excitación. Este efecto se puede 37

49 Introducción deber a dos causas: a la presencia de nanopuntos de diferente tamaño, es decir, al efecto cuántico [Zhao, 2008], o a que la emisión se produce desde diferentes niveles de energía existentes debido la presencia de distintos grupos funcionales [Tang, 2012]. En ocasiones, los nanopuntos desnudos no son fluorescentes y es necesaria la pasivación de la superficie para lograr que lo sean [Bourlinos, 2008; Sun, 2008]. Asimismo, la fluorescencia de los nanopuntos de carbono puede ser amortiguada tanto por aceptores como por dadores de electrones, en un proceso de transferencia electrónica fotoinducida [Li, 2012]. Los nanopuntos de carbono son un material muy interesante debido a que presentan unas propiedades fotofísicas comparables a las de los puntos cuánticos de semiconductores (QDs), tales como su alta eficiencia cuántica o su fotoestabilidad [Baker, 2010]. Además, presentan otras propiedades destacables que los diferencian, como son su alta solubilidad, provocada por la presencia de grupos funcionales hidrofílicos, estabilidad química, facilidad de funcionalización, baja toxicidad y buena biocompatibilidad [Li, 2012], lo que ha propiciado su aplicación como marcadores biológicos [Li, 2010], en bioimagen [Yang, 2009] y transporte de fármacos [Karthik, 2013]. La combinación de las propiedades de los nanopuntos de carbono los convierte en un material excelente para su aplicación en sensores y biosensores ópticos basados en la interacción entre el analito y los nanopuntos, que provoca la amortiguación o la recuperación de la fluorescencia. Así se han descrito sensores para la detección de diferentes analitos, entre otros, iones metálicos, aniones, moléculas orgánicas y biomoléculas [Zuo, 2015]. Sin embargo, a diferencia de otros nanomateriales de carbono, existen pocos ejemplos de su aplicación en sensores electroquímicos [Nguyen, 2016b]. I Síntesis de nanopuntos de carbono Los métodos para la síntesis de nanopuntos de carbono se pueden agrupar en dos categorías generales: métodos físicos (top-down) y métodos químicos (bottom-up). Como se ha comentado anteriormente, los métodos físicos se basan en la ruptura de materiales de carbono de mayor tamaño, como nanotubos de carbono [Xu, 2004; 38

50 Introducción Tao, 2012; Bottini, 2006], grafito [Tao, 2012; Zheng, 2009], nanodiamante [Zhang, 2013] y carbón activo [Dong, 2010]. Entre los métodos físicos el más utilizado es la ablación láser seguida de una etapa de pasivación [Sun, 2006; Li, 2011b]. Otros métodos físicos utilizados en la síntesis de nanopuntos de carbono son la descarga por arco eléctrico [Xu, 2004] y el tratamiento con plasma [Li, 2013; Jiang, 2010]. Los métodos químicos se basan en la utilización de diferentes materiales de partida, que, mediante reacciones químicas, producen nanopuntos de carbono. Entre los métodos químicos descritos en la bibliografía se encuentran la síntesis electroquímica [Zhao, 2008; Zheng, 2009; Li, 2011d; Hou, 2015], las rutas sintéticas soportadas [Liu, 2009a; Lai, 2012; Yang, 2013], combustión [Wang, 2015c; Li, 2015b; Kasibabu, 2015], síntesis hidrotermal [Dong, 2013; Wu, 2013; Xu, 2015; Tong, 2015; Wang, 2015a], oxidación en medio ácido [Liu, 2007; Peng, 2009; Zhang, 2015] y el uso de microondas y ultrasonidos [Zhu, 2009; Wang, 2011b; López, 2015; Chen, 2015]. Los métodos químicos más empleados para la síntesis de nanopuntos de carbono se basan la carbonización de un precursor que actúa como fuente de carbono. La carbonización se puede conseguir mediante diferentes métodos, como calentamiento [Wang, 2015c], hidrotermal [Dong, 2013] y microondas [Chen, 2015]. Se han descrito infinidad de métodos basados en la carbonización de diferentes precursores, tales como el hollín de una vela [Liu, 2007], gas natural [Tian, 2009], citrato de amonio y de octadecilamonio [Bourlinos, 2008], ácido cítrico [Dong, 2013; Wang, 2015b], ácido bórico [Jahan, 2013; Shen, 2014], glicerol [Lai, 2012; Xue, 2011], glucosa [Peng, 2009; Li, 2011a; Yang, 2011; Ma, 2012], etilenglicol [Hu, 2013], N-acetilcisteína [Chen, 2013a], diamina [Sk, 2014] o benceno [Jiang, 2010]. También se han utilizado como precursores fuentes naturales, como zumo de naranja [Sahu, 2012], zumo de plátano [De, 2013], leche de soja [Zhu, 2012], carne [Wang, 2013], bebidas comerciales [Liao, 2015], café [Jiang, 2014], cerveza [Wang, 2015d], huevo [Wang, 2012], patata [Xu, 2015], seda de gusano [Wu, 2013], sacarosa [Peng, 2009; Xu, 2014], almidón [Peng, 2009], e incluso, hierba [Liu, 2012]. Estos precursores suelen ser ricos en grupos funcionales químicos como carboxilos, aminas, hidroxilos que facilitan la posterior modificación para modular las propiedades de los nanopuntos de carbono. 39

51 Introducción Generalmente, tras el proceso de síntesis se lleva a cabo una etapa de purificación, que puede ser una combinación de diferentes técnicas, como ultracentrifugación, filtración, diálisis, cromatografía en columna o electroforesis en gel [Georgakilas, 2015]. I.2.5 Funcionalización de nanomateriales de carbono Como ya se ha comentado, la funcionalización de los nanomateriales se realiza con la finalidad de aumentar sus posibles aplicaciones mediante la incorporación de nuevos grupos funcionales en su superficie. En la funcionalización de los materiales de carbono, se debe tener en cuenta que, desde el punto de vista químico, la superficie de los nanotubos de carbono y del grafeno es esencialmente la misma, por lo que es posible utilizar estrategias similares. Ambas superficies están formadas teóricamente por una lámina de carbonos sp 2 unidos entre sí formando una red bidimensional de estructuras hexagonales. Sin embargo, estos materiales presentan defectos en su estructura, tales como ciclos de cinco o siete carbonos, ausencia de uno o varios átomos de carbono, presencia de átomos intersticiales o presencia de heteroátomos u otras impurezas [Banhart, 2011]. La presencia de estos defectos va a influir fuertemente en la química de la superficie de los nanomateriales de carbono, ya que el plano basal es muy poco reactivo, mientras que los bordes o los defectos son sitios activos con una alta reactividad [Hirsch, 2005; Loh, 2010; Bahr, 2002], lo que va a permitir la unión covalente de moléculas que aporten nuevas funcionalidades. Además, en el caso de los nanotubos de carbono, la curvatura de la superficie aumenta su reactividad [Malig, 2011]. Por otro lado, el plano basal de los nanomateriales de carbono presenta una alta densidad electrónica π, lo que favorece la adsorción de moléculas sobre su superficie [Radovic, 1997]. Esto resulta de utilidad para lograr la funcionalización no covalente y, además, hace que la superficie presente una ligera basicidad [Leon y Leon, 1992]. Teniendo en cuenta estas propiedades, se puede decir que hay dos tipos de métodos generales de funcionalización de los nanomateriales de carbono en función del mecanismo de unión entre los compuestos funcionales y el nanomaterial: covalente y no covalente. 40

52 Introducción I Métodos de funcionalización no covalente La funcionalización no covalente no altera la conjugación π [Georgakilas, 2012; Simmons, 2009]. Por este motivo hay un gran interés en el desarrollo de interacciones no covalentes entre los nanomateriales de carbono y los componentes funcionales. Este tipo de funcionalización resulta muy útil cuando se quieren modificar superficies con una estructura ordenada con áreas en las que abundan los carbonos aromáticos, que presentan un sistema electrónico π deslocalizado, como es el caso de los nanotubos de carbono [Simmons, 2009; Chen, 2001b] o el grafeno [Bai, 2009; Kuila, 2012]. Se puede realizar mediante interacciones hidrofóbicas [Zhang, 2006], apilamiento π-π [Zhao, 2009], por envoltura con polímeros [O Connell, 2001; Enyashin, 2007] o, en el caso de los nanotubos, por interacciones endoédricas [Hirsch, 2002]. El primer método, interacción hidrofóbica, consiste en utilizar surfactantes, es decir, compuestos formados por cadenas alifáticas que, por un extremo, interaccionan con la superficie hidrofóbica del carbono y, por el otro, funcionalizan la superficie con grupos hidrofílicos químicamente activos. Un ejemplo muy utilizado de funcionalización de nanotubos de carbono para lograr su solubilización es el empleo del surfactante aniónico dodecilsulfato sódico (SDS), que se adsorbe a la superficie de los nanotubos y los recubre con grupos sulfato [Yu, 2007]. Se ha descrito también la utilización de surfactantes catiónicos, como el bromuro de dodeciltrimetilamonio (DTAB) [Whitsitt, 2003] o no iónicos, como el polioxoetilenoctilfeniléter (Triton X-100) [Geng, 2008]. El segundo método, apilamiento π-π, tiene lugar con moléculas que presentan grupos aromáticos capaces de interaccionar con las regiones aromáticas de las superficies de carbono, por ejemplo, moléculas con un grupo pireno en su estructura, que se puede unir al plano basal del grafeno [Loh, 2010] o a las paredes de los nanotubos de carbono [Leyden, 2010] mediante interacciones π-π, actuando como un punto de anclaje para la unión de diferentes grupos funcionales. El método de envoltura con polímeros se basa en la adsorción de una molécula polimérica en la superficie de los nanomateriales de carbono a través de interacciones electrostáticas de manera que forma una capa protectora. Los grupos 41

53 Introducción funcionales presentes en el polímero pueden promover la unión de diferentes compuestos orgánicos e inorgánicos [Luong, 2004]. En el método endoédrico las moléculas penetran a través de defectos en los extremos o en las paredes mediante capilaridad en las cavidades internas de los CNTs, donde se almacenan. Se conocen casos de inserción de nanopartículas, tales como C 60, oro, plata y platino [Georgakilas, 2007], así como de pequeñas biomoléculas, como proteínas o ADN [Hirsch, 2002; Tsang, 1997]. Además de los métodos químicos descritos, existe otro modo de funcionalizar los materiales de carbono de manera no covalente y es mediante el uso de métodos electroquímicos. Así, se puede lograr el crecimiento de películas delgadas sobre la superficie del nanomaterial a través de la electropolimerización de un monómero [Gao, 2000; Chen, 2001b]. Aunque el polímero formado interacciona de manera no covalente con la superficie de carbono, es posible que se produzca en parte una unión covalente por reacción con los grupos funcionales existentes en la superficie [Bleda-Martínez, 2007]. Un ejemplo de este tipo de modificación de la superficie es la electropolimerización de polianilina sobre fibras de carbón activado [Salinas-Torres, 2013]. I Métodos de funcionalización covalente La funcionalización covalente se basa en la formación de enlaces covalentes entre los compuestos funcionales y los átomos de carbono, tanto de los bordes o extremos abiertos de los nanotubos como del plano basal de las superficies de carbono. Como se ha comentado, la reactividad del plano basal depende en gran medida de la presencia de defectos, por lo que una posible estrategia para la funcionalización covalente de los materiales de carbono consiste en la introducción de defectos en su superficie. Estos defectos se pueden crear mediante procesos oxidativos con ácidos fuertes, como HNO 3 o H 2 SO 4 [Esumi, 1996], o con oxidantes fuertes como KMnO 4 [Yu, 1998], ozono [Sham, 2006] o plasma reactivo [Ávila-Orta, 2009] o también mediante el uso de moléculas con una alta reactividad química, como el flúor [Touhara, 2002]. La idea es crear grupos funcionales en la superficie de carbono, que pueden ser precursores de otras reacciones químicas. 42

54 Introducción La modificación de la superficie de los nanomateriales de carbono también se ha llevado a cabo mediante activación fotoquímica. Así, a través de la irradiación de luz UV se han conseguido anclar moléculas de tetraóxido de osmio a la superficie de nanotubos de carbono [Cui, 2003] y grupos fenilo a la superficie del grafeno, por reacción con peróxido de benzoilo [Liu, 2009c]. Al igual que en el caso de la funcionalización no covalente, es posible utilizar técnicas electroquímicas como herramienta para lograr la funcionalización covalente de las nanoestructuras de carbono de manera rápida y eficiente. Por ejemplo, la aplicación de una corriente provoca la aparición de defectos estructurales y grupos oxigenados, a partir de los cuales se pueden introducir nuevas funcionalidades [Moraitis, 2011]. Dentro de la funcionalización asistida mediante técnicas electroquímicas, un método muy eficaz para la funcionalización covalente de las superficies de carbono es el proceso de electroinjerto, que ya ha sido descrito en esta introducción. Este proceso permite incorporar un gran número de grupos funcionales a la estructura de los nanomateriales de carbono, obteniéndose así nanomateriales con diferentes propiedades. El electroinjerto puede llevarse a cabo mediante reducción de sales de diazonio [Xia, 2016] o compuestos vinílicos [Defever, 2006]. La gran variedad de métodos disponibles para la funcionalización, tanto covalente como no covalente, de los nanomateriales de carbono permite incorporar un número casi ilimitado de funcionalidades en la superficie de estos, de manera que se amplía enormemente el alcance de sus aplicaciones. I.3. Electrodos modificados con biomoléculas. Biosensores En la definición de biosensor electroquímico proporcionada para la IUPAC se establece que es un dispositivo capaz de proporcionar información analítica específica, de manera cuantitativa o semicuantitativa, utilizando un elemento de reconocimiento biológico que se encuentra en contacto directo con un transductor electroquímico [Thévenot, 2001]. Este elemento de reconocimiento biológico aporta al sensor la selectividad necesaria para su utilización en matrices complejas, sin que sea necesario realizar procesos previos de separación. El desarrollo de los biosensores está ligado a la evolución de la biología molecular y de las técnicas de 43

55 Introducción análisis instrumental, lo que ha supuesto una mejora en el diseño de los sistemas, obteniéndose biosensores sencillos, miniaturizables, de menor coste y mayor aplicabilidad. Esto ha hecho posible el desarrollo de biosensores para un gran número de aplicaciones dentro del campo clínico, industrial, medioambiental y alimentario [Wang, 2004b]. La clasificación de los biosensores puede realizarse de acuerdo a diferentes criterios. Así, en función del tipo de interacción entre el elemento de biorreconocimiento y el analito, se pueden clasificar en biosensores catalíticos y biosensores de afinidad [Thévenot, 2001]. Los biosensores catalíticos se basan en una reacción catalizada por una macromolécula que actúa como biocatalizador. Los biocatalizadores más comúnmente utilizados son las enzimas, microorganismos o tejidos. Los biosensores de afinidad se basan en la interacción entre el analito y el biorreceptor. Entre estos biosensores se encuentran los biosensores de ADN. I.3.1 Biosensores enzimáticos Las enzimas son biocatalizadores naturales de naturaleza proteica. Presentan alta eficiencia catalítica y elevada selectividad, lo que las convierte en unos catalizadores muy sofisticados. En una reacción catalizada por una enzima, la unión del sustrato a la enzima se produce en una región concreta de la misma denominada centro activo. Una vez formado el producto, la enzima se regenera de manera que es posible comenzar nuevamente el ciclo de reacción. Para ello, en ocasiones, es necesaria la presencia de cofactores. Las enzimas se utilizan habitualmente como elemento de biorreconocimiento en el desarrollo de biosensores, ya que, además de su elevada selectividad y sensibilidad, presentan otras múltiples ventajas, como capacidad de autorregeneración, gran variedad de enzimas disponibles, rápida respuesta, posibilidad de monitorización continua y capacidad de detectar tóxicos por inhibición de su actividad catalítica, entre otras. Entre las enzimas más empleadas destacan las oxidorreductasas, que catalizan reacciones de oxidación o reducción [Mello, 2002]. Este tipo de enzimas tiene un especial interés en la construcción de biosensores amperométricos, ya que en la 44

56 Introducción transformación enzimática del sustrato tiene lugar una transferencia de electrones. Dentro de este grupo se encuentran las enzimas oxidasas, que utilizan el oxígeno molecular como aceptor de electrones en el ciclo catalítico. I Biosensores basados en la enzima lactato oxidasa La enzima lactato oxidasa (LOx) proveniente de Pediococcus sp. (figura I.7) cataliza la oxidación de lactato a piruvato y peróxido de hidrógeno. Pertenece a la familia de las flavoenzimas (α-hidroxiácido oxidasa), es decir, incorpora un cofactor de tipo flavina fuertemente enlazado en su estructura. La interacción de este cofactor, el flavín mononucleótido (FMN), con el sustrato es la responsable de la gran especificidad de esta enzima por el lactato [Umena, 2006]. Estructuralmente, está formada por dos tetrámeros compactamente empaquetados en una unidad asimétrica [Leiros, 2006]. Cada tetrámero forma una unidad biológicamente activa y tiene un peso molecular de 160 kda. Fig. I.7. Estructura de la enzima lactato oxidasa. La determinación de la concentración de lactato es de gran importancia en diferentes ámbitos, como el clínico, el agroalimentario o la medicina deportiva. La concentración de lactato en sangre en individuos sanos en reposo se encuentra entre 0.5 y 1.5 mm y puede aumentar hasta 12.0 mm durante el ejercicio [Stanley, 1985]. Bajo condiciones de ejercicio excesivo el nivel de lactato puede superar la capacidad de tamponamiento de las células, resultando en acidosis láctica, que puede afectar al 45

57 Introducción funcionamiento de los músculos [Kemp, 2005]. Esto se conoce en medicina deportiva como el umbral láctico y es un indicador del nivel de entrenamiento de un atleta [Kemp, 2005]. De manera similar, el nivel de lactato en sangre se utiliza como indicador en el diagnóstico de pacientes en procesos de cuidados intensivos y operaciones quirúrgicas, ya que está relacionado con la presencia de diferentes patologías como choque cardiogénico [Karlsson, 1975], fallo respiratorio [De Backer, 1997] o enfermedades hepáticas [Kruse, 1987], entre otras. Por otro lado, la fermentación láctica es un proceso importante en la industria alimentaria. Los niveles de lactato indican la estabilidad, frescura y calidad de muchos productos lácteos, como leche, yogur o cremas, así como de carne, frutas y vegetales [Przybyt, 2014]. Además, en la producción de vino, la fermentación maloláctica, llevada a cabo por las bacterias presentes en las uvas y en el mosto, tiene lugar tras la fermentación alcohólica y convierte el ácido málico en ácido láctico, reduciendo la acidez del vino y produciendo una mejora en el sabor del producto final. Por este motivo, en el control de calidad de los vinos es importante la monitorización de los niveles de ácidos láctico y málico presentes en el vino joven [Przybyt, 2014]. Entre los métodos analíticos convencionales para la determinación de lactato destacan el análisis cromatográfico y el ensayo colorimétrico [Madrid, 1999]. Sin embargo, estos métodos son largos y complejos debido al proceso de pretratamiento de la muestra y la preparación de reactivos, por lo que el desarrollo de biosensores para la determinación de este analito es de gran interés por las ventajas que ofrecen estos dispositivos. Concretamente, los biosensores amperométricos basados en reacciones enzimáticas suponen una mejora en cuanto a especificidad, selectividad, respuesta, tamaño y reproducibilidad [Foster, 2000; Vidal, 2003; Qiaocui, 2005; Zhou, 2006], ya que se combina la sensibilidad de las técnicas electroquímicas con la elevada selectividad proporcionada por la unión específica enzima-sustrato [Suman, 2005]. La determinación de lactato mediante el uso de la enzima lactato oxidasa (LOx) se basa en la conversión de ácido láctico en ácido pirúvico en presencia de oxígeno, según la reacción: L-lactato + O 2 piruvato + H 2 O 2 46

58 Introducción En los biosensores amperométricos desarrollados utilizando esta enzima, la detección de lactato se lleva a cabo típicamente mediante la monitorización del consumo de O 2 [Makovos, 1985] o de la producción de H 2 O 2 [Lamas-Ardisana, 2014; Loaiza, 2015]. En estas condiciones, el O 2 actúa como mediador natural en la detección electroquímica de lactato, según las reacciones: L-lactato + LOx ox piruvato + LOx red LOx red + O 2 LOx ox + H 2 O 2 H 2 O 2 2e - O 2 Tras la oxidación del sustrato y reducción de la enzima, el O 2 actúa como aceptor natural de electrones y regenera la enzima produciendo H 2 O 2, que se oxida sobre el electrodo. La corriente anódica producida es proporcional a la cantidad de H 2 O 2 producido y, por tanto, a la concentración de lactato presente en la muestra. En el caso del consumo de O 2 este es directamente proporcional a la cantidad de lactato transformado. Sin embargo, tanto la reducción de O 2, como la oxidación de H 2 O 2 requieren sobrepotenciales muy elevados, lo que conlleva serios problemas de interferentes. Con el objeto de minimizar la contribución de las sustancias interferentes en la respuesta del biosensor se han descrito diferentes metodologías para reducir el sobrepotencial impuesto al sistema biosensor, tales como el uso de compuestos electrocatalizadores, como el azul de Prusia [Liu, 1997], o la ftalocianina de cobalto [Iwuoha, 1999]; aumento de la sensibilidad mediante la coinmovilización de peroxidasa de rábano y lactato oxidasa [Pérez, 2012; Yang, 2012a]; aumento del área efectiva del electrodo por modificación con nanomateriales como nanotubos de carbono [Goran, 2011], nanopartículas de oro [Gamero, 2010] o de platino [Yu, 2013]; o sustitución del aceptor natural de electrones (O 2 ) por un mediador redox. Esta última estrategia es la utilizada en los llamados biosensores electroquímicos de segunda generación, que utilizan mediadores de transferencia de carga para facilitar el paso de los electrones desde la enzima hasta la superficie del electrodo. En este caso, la regeneración de la enzima tras ser reducida al oxidar el lactato se produce a través del mediador redox. Posteriormente, el mediador se regenera sobre la 47

59 Introducción superficie del electrodo mediante una reacción electroquímica, como se muestra en el esquema de la figura I.8. Así, los mediadores artificiales actúan como aceptor de electrones en lugar del oxígeno molecular y transfieren los electrones desde la forma reducida de la enzima al electrodo. De esta manera, el potencial de trabajo del electrodo corresponde al potencial formal del mediador, reduciendo así el sobrepotencial necesario para la determinación de lactato. Lactato Piruvato LOx red LOx ox mediador red mediador ox e - ELECTRODO Fig. I.8. Esquema del proceso de regeneración de la enzima mediante el uso de un mediador redox. Entre los mediadores utilizados en el desarrollo de biosensores basados en la enzima lactato oxidasa se ha descrito el uso de polímeros conductores, como el polipirrol [Khan, 1997], poli(pirrol)-poli(vinilsulfonato) o poli(vinilpirrolidona) [Kenausis, 1996]; complejos de metales de transición, como complejos de osmio [Park, 1997] o derivados del ferroceno [Parra, 2006b; Boujtita, 1996]; o colorantes orgánicos como verde de metileno [Kulys, 1993], azul de Meldola [Pereira, 2011], tetratiofulvaleno [Marzouk, 1997] o grupos quinona [Haccoun, 2004]. La desventaja de estos dispositivos es la necesidad de tener que añadir el mediador a la disolución. El diseño de sistemas compactos que incorporen el mediador redox supone una gran ventaja. Por todo ello, debido a la importancia de este analito, existe un gran interés en el desarrollo de nuevos dispositivos biosensores para la determinación de lactato, que permitan mejorar las propiedades analíticas de los biosensores descritos en la bibliografía, especialmente, en términos de sensibilidad y estabilidad. I.3.2 Biosensores electroquímicos de ADN Los métodos para la identificación de secuencias específicas de ácidos nucleicos atraen un gran interés debido a la creciente necesidad de identificar microorganismos 48

60 Introducción patógenos en diferentes matrices, como agua y alimentos, además de estudiar enfermedades humanas provocadas por mutaciones genéticas. El descubrimiento de las secuencias genómicas tanto de esos patógenos como humanas ha resultado de gran utilidad en el estudio de los factores causantes de determinadas enfermedades. La detección de secuencias específicas de ADN puede ser empleada en el diagnóstico clínico de enfermedades genéticas hereditarias, en el estudio de los patógenos y de sus enfermedades asociadas. Entre los diferentes tipos de enfermedades genéticas causadas por alteraciones en la secuencia de ADN el mayor reto lo supone la detección de polimorfismos de un solo nucleótido (SNPs). Un polimorfismo de un solo nucleótido es una variación en una sola base nitrogenada en una secuencia de ADN en el genoma de diferentes miembros de una especie biológica o entre un par de cromosomas en un individuo [Raven, 2017]. Esta mutación es consecuencia de un error en la replicación y puede ser la causa directa de una enfermedad o de la predisposición de un individuo a sufrir determinadas patologías. Por tanto, el reconocimiento de secuencias específicas de ADN y la detección de los polimorfismos de un solo nucleótido son importantes para el diagnóstico temprano de enfermedades genéticas, así como para el diseño de productos farmacéuticos, seguridad alimentaria o protección ambiental [He, 2005]. Los métodos convencionales de análisis de ADN están basados en la secuenciación de las cadenas de ADN marcadas radiactivamente. La secuenciación es un proceso complejo, que requiere largos tiempos de análisis, además de las limitaciones que presenta en cuanto a seguridad para el operador y para el medioambiente. Por ello, es de gran interés el desarrollo de dispositivos que permitan la detección de secuencias de ADN de forma rápida, sencilla, barata y segura. Con el fin de satisfacer esta demanda surgen los biosensores de ADN. Estos se basan en la hibridación de secuencias de ADN, que presenta una alta especificidad. Como elemento de reconocimiento biológico se utiliza una secuencia de ADN de cadena sencilla denominada sonda, complementaria en mayor o menor medida con la secuencia que se pretende determinar, denominada secuencia analito. El biosensor de ADN debe ser capaz de proporcionar una señal analítica que permita determinar si se ha producido la hibridación entre la sonda y la secuencia analito y, además, 49

61 Introducción cuantificar la magnitud del proceso de biorreconocimiento. Esta señal puede ser eléctrica, óptica, térmica o piezoeléctrica [Kavita, 2017]. Los biosensores electroquímicos presentan la ventaja de generar una señal analítica directa y, además, son fácilmente miniaturizables, por lo que son muy utilizados. El desarrollo de un biosensor electroquímico de ADN incluye las etapas que a continuación se describen. 1. Inmovilización de la sonda 2. Hibridación con la secuencia analito 3. Detección electroquímica del evento de hibridación I Inmovilización de la sonda de ADN El proceso de inmovilización de la sonda tiene una especial importancia en la construcción de biosensores de ADN, ya que de ella dependen la sensibilidad y selectividad del biosensor. La orientación de la sonda sobre el electrodo, así como su accesibilidad y estabilidad, necesarias para que la eficiencia del evento de hibridación sea lo mayor posible, dependen en gran medida del control de la superficie y el recubrimiento. Además, con el objeto de optimizar la selectividad del biosensor es importante minimizar la adsorción inespecífica a la superficie del electrodo. Se han descrito numerosos métodos de inmovilización de la sonda sobre diferentes tipos de electrodos, tales como adsorción [Jahanbani, 2016; Wang, 1998; del Pozo, 2005a], electrodeposición [Oliveira, 2015], formación de monocapas autoensambladas de sondas modificadas con un grupo tiol [García-Mendiola, 2016; Nakayama, 2002; Peng, 2006; Steel, 1998], formación de un enlace covalente, que puede ser mediante sales de diazonio [Revenga-Parra, 2014] o por formación de enlace entre una amina y un ácido carboxílico [Cai, 2003b; Popovich, 2002], mediante interacción entre avidina y biotina [Chung, 2011; Hernández-Santos, 2004; Huang, 2002], inmovilización en polímeros conductores [Rahman, 2015; Komarova, 2005; Thompson, 2003], en membranas bilipídicas [Zhou, 2008; Fajkus, 2002] o por inclusión en pasta de carbono [Wang, 1998]. Entre todos estos métodos, los basados en la formación de un enlace covalente, en la quimisorción de tioles o en la interacción entre avidina y biotina permiten obtener 50

62 Introducción electrodos modificados con ADN ordenados y controlados. Además, mediante la utilización de estos métodos se puede conseguir una disposición vertical de la sonda inmovilizada, lo que, en principio, debería favorecer la hibridación al aumentar la accesibilidad a la sonda. Sin embargo, estos métodos requieren la modificación química de la sonda de ADN en el extremo 5 con un grupo funcional (tiol o amina) o con biotina para conseguir la unión deseada. La adsorción directa sobre la superficie del electrodo es el método más sencillo de inmovilización de la sonda. Este método permite la utilización de cadenas de ADN no modificadas, sin embargo, se ha de utilizar de forma que permita el control de la disposición de sonda a fin de que mantenga la capacidad de biorreconocimiento. La modificación de la superficie con nanoestructuras puede conseguir este efecto, favoreciendo la orientación de la sonda sobre el electrodo nanoestructurado. I Hibridación con la secuencia complementaria Una vez inmovilizada la sonda, la siguiente etapa consiste en la hibridación de esta con su cadena complementaria. Los biosensores de ADN utilizan como evento de biorreconocimiento esta hibridación, que es el proceso por el que se unen dos cadenas de nucleótidos por reconocimiento de complementariedad entre su secuencia de bases nitrogenadas. La unión entre los pares de bases se produce mediante enlaces de hidrógeno. Así, adenina (A) y timina (T) son bases complementarias entre sí, que se unen mediante dos enlaces de hidrógeno, al igual que lo son citosina (C) y guanina (G), que se unen mediante tres enlaces de hidrógeno. Esta complementariedad entre las bases proporciona la gran especificidad que presentan los biosensores de ADN. Una característica que presenta la reacción de hibridación es que es una reacción reversible. La doble hélice de ADN puede separarse en dos cadenas sencillas por desnaturalización en determinadas condiciones del medio de reacción, tales como temperatura, ph o la presencia de agentes desnaturalizantes. De manera muy interesante, al restablecerse las condiciones originales las cadenas vuelven a unirse de nuevo formando la doble cadena. 51

63 Introducción La especificidad derivada de la complementariedad de las bases y la reversibilidad de la reacción son dos propiedades de la reacción de hibridación muy útiles para su aplicación en el desarrollo de dispositivos analíticos. I Detección electroquímica del evento de hibridación La detección del evento de hibridación mediante métodos electroquímicos puede realizarse directa o indirectamente, es decir, utilizando o no secuencias marcadas o indicadores. Los métodos directos se basan en la electroactividad intrínseca de las bases nitrogenadas [Ahour, 2017; Ozkan-Ariksoysal, 2017; Kara, 2002; Lucarelli, 2002] o en el cambio en las propiedades eléctricas de la interfase entre el electrodo y la disolución al modificarlo con el ADN [Ensafi, 2011; Wang, 2017; Cai, 2003a]. Los métodos indirectos, en cambio, se basan en el uso de cadenas marcadas, bien con enzimas [Kim, 2003; Suye, 2005], bien con nanopartículas [Rasheed, 2014; Zheng, 2014; Merkoçi, 2005; Zhu, 2003]; o en el uso de indicadores electroquímicos [García-Mendiola, 2016; García, 2008b; Shi, 2014; del Pozo, 2005b; Erdem, 2001; Millan, 1993]. De entre estos métodos, los más utilizados son la detección directa mediante la señal electroquímica generada por las bases nitrogenadas y la detección indirecta mediante el uso de indicadores electroactivos. Este segundo método presenta la ventaja de ofrecer una mayor especificidad. Por ello, ha habido un gran interés en la búsqueda de indicadores electroquímicos, es decir, moléculas que presentan la capacidad de unirse preferentemente al ADN de cadena doble. Millan y Mikkelsen describieron por primera vez el uso de un indicador de este tipo, el complejo [Co(fenantrolina) 3 ] 3+, para detectar la hibridación del ADN [Millan, 1993]. En este tipo de biosensores de ADN, tras la inmovilización de la sonda, se hace interaccionar al indicador electroquímico con el electrodo modificado con ADN antes y después de la hibridación con la secuencia analito y la magnitud de la interacción se evalúa a partir de la señal del indicador [Ferapontova, 2011]. Un buen indicador electroquímico debe permitir discriminar entre ADN de cadena doble y sencilla, consiguiéndose así una detección selectiva y sensible de las secuencias de ADN analito. 52

64 Introducción Los indicadores pueden interaccionar con el ADN de distintas formas: interacción electrostática, interacción a través de los surcos e intercalación, aunque en muchos casos la interacción se produce de un modo combinado, especialmente las moléculas cargadas que, además, pueden unirse a través de los surcos o por intercalación. La interacción electrostática se produce por la atracción o repulsión entre una molécula cargada y el esqueleto del ADN, que contiene grupos fosfato que están cargados negativamente. Este tipo de interacción se da en mayor extensión con la cadena doble que con la cadena sencilla, aunque no es selectiva, por lo que es la interacción menos específica. Además, depende fuertemente de la fuerza iónica y el ph de la disolución. Como indicadores electroquímicos que presentan interacción electrostática con el ADN se han utilizado complejos metálicos como el hexaamín rutenio (III), [Ru(NH 3 ) 6 ] 3+ [Wang, 1996b], o el [Co(fenantrolina) 3 ] 3+ [Millan, 1993] o compuestos orgánicos como la adriamicina [Shi, 2014]. La interacción a través de los surcos se produce por la unión de moléculas pequeñas a los surcos de la doble hélice del ADN a través de enlaces de hidrógeno o interacciones de van der Waals o electrostáticas. Entre las moléculas que presentan interacción con el ADN a través de los surcos y que se ha descrito su uso como indicador electroquímico del evento de hibridación se encuentran el colorante Hoecht [Hashimoto, 1994; Hashimoto, 1998] y los ligandos N,N -bis(2,5-dihidroxibenciliden)-1,2-diaminobenceno (2,5-DHS) y N,N -bis(3,4-dihidroxibenciliden) -1,2-diaminobenceno (3,4-DHS) [Revenga- Parra, 2007]. La interacción por intercalación es la más selectiva y se produce por la inserción de una molécula entre los pares de bases adyacentes en la doble cadena de ADN. Los intercaladores suelen ser moléculas ricas en grupos aromáticos y, por lo tanto, planas, que se intercalan en una posición aproximadamente perpendicular a la doble hélice. El intercalador más conocido es el bromuro de etidio, que se ha utilizado extensamente como revelador en electroforesis en gel para estudiar secuencias de ADN [Liu, 1996; Castro, 2014]. Entre los indicadores electroquímicos que se intercalan se encuentran moléculas orgánicas, como la daunomicina [Marrazza, 1999], la doxorrubicina [Ting, 2009], el naranja de acridina [Kapuscinski, 1983], ferrocenilnaftaleno [Yamashita, 2002], viológeno [Pang, 2000], safranina [García-Mendiola, 2016] o azul de metileno [Kelley, 1999; Kelley, 1997], o complejos metálicos con ligandos planares, como [Co(bipiridina) 3 ] 3+ 53

65 Introducción [Millan, 1994], [Os(2,2 -bipiridil) 2 (1,10-fenantrolina-5,6-diona)] 3+/2+ o [Os(1,10- fenantrolin) 2 (1,10-fenantrolina-5,6-diona)] 3+/2+ [del Pozo, 2005b], [Ru(3-(2-fenantren-9-ilvinil)-piridina)] [García, 2008a] o poli(4-vinilpiridina)-[os(5,6-dimetil-1,10-fenantrolina)2cl] 2+ [Liu, 2004], entre otros. En todos los casos, la diferencia en la respuesta electroquímica del indicador al interaccionar con el ADN de cadena sencilla o doble permite discriminar entre ambos. Esta diferencia puede manifestarse como un desplazamiento del potencial formal del indicador electroquímico o a un cambio en la intensidad corriente [Ferapontova, 2011]. Por tanto, a la hora de elegir el indicador electroquímico para el análisis de ADN se deben tener en cuenta la especificidad en su interacción con el ADN, el valor del potencial redox, la reversibilidad del proceso redox y, además, la eficiencia de la transferencia electrónica entre el electrodo y el indicador redox. Estos factores van a influir en las propiedades analíticas del biosensor de ADN, por lo que la búsqueda de nuevos indicadores electroactivos que ofrezcan una mejor respuesta tiene un gran interés en el desarrollo de dispositivos biosensores con mayor sensibilidad y selectividad. I.4 Aplicación analítica de los electrodos modificados Teniendo en cuenta las necesidades analíticas actuales, el objetivo de esta tesis doctoral consiste en el desarrollo de nuevos métodos de análisis para la determinación de analitos de interés clínico, agroalimentario y medioambiental. La investigación se ha centrado en la construcción de dispositivos sensores y biosensores electroquímicos sensibles, estables y robustos para la determinación de hidrazina, NADH, peróxido de hidrógeno y lactato. En el desarrollo de estos dispositivos se han utilizado nanomateriales funcionalizados con el fin de mejorar las propiedades analíticas de los sistemas sensores y biosensores gracias a las propiedades combinadas que presentan los nanomateriales intrínsecamente y las que aportan las funcionalidades incluidas en ellos a través de la funcionalización. Esto permite obtener una mayor sensibilidad y selectividad, además de estabilidad y reproducibilidad. Debido al gran interés que despierta esta línea de investigación, existe una amplia bibliografía sobre este tema. A modo de ejemplo, en las tablas siguientes se presentan algunos sensores (tabla I.1) y biosensores (tabla I.2) construidos mediante modificación de electrodos con nanomateriales funcionalizados desarrollados en los últimos años. 54

66 Introducción Pb 2+ H2O2 H2O2 Tabla I.1. Sensores químicos basados en electrodos modificados con nanomateriales funcionalizados. nanomaterial rgo/polidan rgo/pani rgo/pss GO/CuTPP GO/PANI y tirosinasa rgo/zno rgo/fenps rgo/poli-azul de metileno rgo/pah GO/azure A GO/hemina electrodo platino FTO GCE membrana de PVC GCE GCE GCE grafito CSPE oro GC referencia [Nguyen, 2016a] [Ameen, 2012] [Wang, 2010] [Poursaberi, 2012] [Chen, 2013b] [Palanisamy, 2012] [Amanulla, 2017] [Erçarıkcı, 2014] [Istrate, 2016] [Gómez-Anquela, 2014] [Zou, 2015] DAN: 1,5-diaminonaftaleno; SWASV: voltamperometría de redisolución anódica de onda cuadrada; PANI: polianilina; FTO: óxido de estaño fluorado; LSV: voltamperometría de barrido lineal; GCE: electrodo de carbón vítreo; PSS: sulfonato de poliestireno; CuTPP: Cu(II) 5-4 (aminofenil)-10,15,20-trifenil porfirina; PVC: cloruro de polivinilo; CV: voltamperometría cíclica; FeNPs: nanopartículas de hierro; PAH: hidrocloruro de polialilamina; CSPE: electrodo serigrafiado de carbono; DPV: voltamperometría diferencial de impulsos; AA: ácido ascórbico; DA: dopamina; UA: ácido úrico modificación adsorción electrodeposición adsorción atrapamiento adsorción electrodeposición adsorción electrodeposición adsorción enlace covalente adsorción analito hidrazina hidrazina salicilato fenol nitrito NADH NADH AA, DA, UA técnica SWASV LSV cronoamperometría potenciometría CV cronoamperometría cronoamperometría CV DPV cronoamperometría DPV 55

67 Introducción MWCNTs/[RhL]PF6 Tabla I.1. Sensores químicos basados en electrodos modificados con nanomateriales funcionalizados. (cont.) referencia [Florea, 2015] [Fakhari, 2015] [Abad, 2011] [Hassan, 2015] [Gu, 2017] [Fu, 2015] [Baghayeri, 2016] [Hallaj, 2016] [D Souza, 2016] [Wayu, 2017] DTYB: 4,5-dihidro-1,3-tiazol-2-ilsulfanil-3-metil-1,2-bencenodiol; FeIIIMPIX: metaloporfirina; MPBA: ácido 4-mercaptofenilborónico; AgNPs: nanopartículas de plata; SH-β-CD: mono-6-tio-β-ciclodextrina; SWV: voltamperometría de onda cuadrada; L: (piridinin-2-il-2-fenil)2(fendiona) nanomaterial AuNPs/p-aminotiofenol AuNPs/poliDTYB AuNPs/3,4-DHS AuNPs/ibuprofeno AuNPs/FeIIIMPIX y MPBA AuNPs/SWCNTs/SH-β-CD MWCNTs/metformina y AgNPs MWCNTs/ácido 4- aminobenzoico MWCNTs/β-ciclodextrina electrodo oro MWCNTs/GCE CSPE GCE GCE GCE GCE GCE pasta de carbono GCE modificación electrodeposición adsorción electrodeposición adsorción adsorción adsorción adsorción adsorción atrapamiento adsorción analito 17β-estradiol hidrazina NADH azul de metileno glucosa metilparatión glucosa nitrito L-tirosina ácido úrico técnica LSV CV CV DPV DPV SWV cronoamperometría cronoamperometría cronoamperometría cronoamperometría 56

68 Introducción MWCNTs/[Ru(L2](PF6)2 Tabla I.2. Biosensores químicos basados en electrodos modificados con nanomateriales funcionalizados. nanomaterial rgo/pccooh rgo/trietilentetramina GO/ferroceno rgo/fenotiazona AuNPs/ AMPPH AuNPs/ácido tióctico AuNPs/p-aminotiofenol AuNPs/cistamina MWCNTs/QDs MWCNTs/IgG SWCNTs/politirosina referencia [Chekin, 2016] [Ren, 2016] [Dey, 2013] [Ravenna, 2015] [Li, 2014] [Gómez- Anquela, 2015] [Azak, 2016] [Campanhã Vicentini, 2016] [Ertek, 2016] [Reuillard, 2014] [Sanchez- Tirado, 2016] [Eguílaz, 2016] PCCOOH: ácido 1-pirenocarboxílico ; GOx: glucosa oxidasa; ChOx: colesterol oxidasa; ChEt: colesterol esterasa; GDH: glucosa deshidrogenasa; AMPPH: hexafluorofosfato de 4-amino-1-(3-mercapto-propil)-piridina; HIgG: inmunoglobulina G humana; ADH: alcohol deshidrogenasa; QDs: puntos cuánticos (ZnS-CdS); L2: (fendiona)2 (4-metil-4 -butilpirrol-2,2 -bipiridina); TGF: factor de crecimiento transformante elemento biológico antigliadina GOx ChOx/ChEt GDH anti-higg ADH GOx tirosina GDH GDH anti-tgf ADH electrodo GCE oro CSPE GCE GCE CSPE oro GCE GCE GCE CSPE GCE modificación adsorción enlace covalente adsorción adsorción atrapamiento adsorción electrodeposición adsorción adsorción adsorción adsorción adsorción analito gliadina glucosa colesterol glucosa HIgG etanol glucosa catecol glucosa glucosa citocina TGF etanol técnica DPV cronoamperometría cronoamperometría cronoamperometría DPV DPV amperometría cronoamperometría CV cronoamperometría amperometría cronoamperometría 57

69 Introducción Entre los analitos estudiados se encuentra el NADH, que es un cofactor asociado a enzimas deshidrogenasas y cuya cuantificación permite la cuantificación indirecta de los sustratos enzimáticos. También se ha determinado hidrazina, que es un analito de interés medioambiental utilizado en una gran variedad de procesos industriales y que es un compuesto tóxico, incluso cancerígeno. Asimismo se ha desarrollado un sensor para la determinación de peróxido de hidrógeno, que es un compuesto de gran interés en el desarrollo de celdas de combustible y además, es un subproducto de reacciones enzimáticas catalizadas por enzimas oxidasas. Por otro lado, se ha desarrollado un biosensor enzimático para la determinación de lactato. La importancia de este analito tiene interés en ámbitos tan diferentes como el clínico, la medicina deportiva o en control de calidad agroalimentaria. Finalmente, en el presente trabajo se ha desarrollado un biosensor electroquímico de ADN que permite la detección de secuencias específicas y de alteraciones en una sola base en secuencias de ADN cortas como la de la bacteria Helicobacter pylori. Esta bacteria es causante de enfermedades gástricas e incluso cáncer y la presencia de mutaciones la convierte en resistente a determinados antibióticos. La aplicabilidad del dispositivo desarrollado a la detección de alteraciones de una sola base en secuencias largas, de más de 100 pares de bases, se ha demostrado mediante su aplicación en la detección de mutaciones en el gen CFTR asociadas a la fibrosis quística, en muestras reales amplificadas por PCR. La determinación de todos los analitos estudiados tiene una gran importancia y, por ello, existe un gran interés en la búsqueda de nuevos métodos que permitan su análisis de manera rápida y sencilla. En este sentido, los (bio)sensores desarrollados en este trabajo se plantean como métodos competitivos para lograr este objetivo, especialmente en el caso de los biosensores de ADN para la determinación de mutaciones genéticas directamente en muestras reales, que suponen un método alternativo y mucho más sencillo y económico que los actualmente utilizados (secuenciación del gen) y comparable en prestaciones a los métodos de cribado que se utilizan actualmente como la temperatura de desnaturalización de alta resolución (HRM) [Audrezet, 2008]. 58

70 Objetivos

71

72 Objetivos El objetivo general de esta tesis doctoral es el desarrollo de dispositivos sensores y biosensores electroquímicos mediante la modificación de las superficies electródicas con nanomateriales funcionalizados, que mejoren las propiedades analíticas de estos sistemas. Para ello se emplearán diferentes nanomateriales sobre los que se incluirán las funcionalidades deseadas a través de la funcionalización. Para la consecución del objetivo general se plantean una serie de objetivos parciales: Estudiar diferentes estrategias de modificación de electrodos serigrafiados con nanotubos de carbono de pared múltiple (MWCNTs) incluyendo el electroinjerto de sales de diazonio y caracterizar las superficies obtenidas empleando distintas técnicas analíticas. Modificar los electrodos nanoestructurados con N,N-bis(3,4- dihidroxibenciliden)-1,2-diaminobenceno (3,4-DHS). Caracterizar los electrodos modificados y estudiar su capacidad electrocatalítica frente a NADH e hidrazina. Sintetizar grafeno modificado químicamente (rgo-dhs) y nanopartículas de oro funcionalizadas (AuNPs-DHS) mediante el empleo de las propiedades reductoras del 3,4-DHS. Caracterizar los nanomateriales obtenidos mediante técnicas como espectrofotometría de absorción UV-vis y de fluorescencia o espectroscopía Raman. Modificar electrodos serigrafiados de carbono modificados con rgo-dhs y AuNPs-DHS y estudiar su actividad electrocatalítica frente a diferentes moléculas. Teniendo en cuenta las propiedades electrocatalíticas de las diferentes plataformas nanoestructuradas desarrolladas, construir y optimizar sensores para la determinación de analitos como NADH, hidrazina o peróxido de hidrógeno. Desarrollar dispositivos biosensores de lactato basado en la modificación de las plataformas nanoestructuradas desarrolladas con la enzima lactato oxidasa. Optimizar las condiciones de funcionamiento y aplicar a la determinación de lactato en muestras reales. Sintetizar nanopuntos de carbono (CDs) a partir de moléculas orgánicas sencillas y caracterizar el nanomaterial obtenido. Modificar electrodos serigrafiados de oro con los CDs sintetizados y caracterizar la superficie. 61

73 Objetivos Desarrollar un biosensor electroquímico nanoestructurado de ADN para la detección de secuencias específicas, así como de mutaciones puntuales en esas secuencias, utilizando como analito modelo una secuencia sintética de 25 bases procedente de la bacteria Helicobacter pylori. Aplicar el biosensor desarrollado en la detección de mutaciones genéticas asociadas a enfermedades, como la fibrosis quística, en muestras de ADN real de PCR extraído de células sanguíneas, utilizando para ello una secuencia de 373 bases del gen regulador de la conductancia transmembrana de la fibrosis quística. 62

74 Materiales y métodos

75

76 Materiales y métodos M.1. Reactivos, disoluciones y dispersiones M.1.1 Reactivos Comerciales Todos los reactivos comerciales utilizados en este trabajo tienen, al menos, la calidad reactivo para-análisis. Se utilizaron tal como se recibieron, sin ser sometidos a ningún proceso de purificación. Los siguientes reactivos han sido suministrados por Sigma-Aldrich: 3,4- dihidroxibenzaldehído, o-fenilendiamina, dodecil sulfato sódico (SDS), hidróxido sódico (NaOH), fosfato sódico dibásico, fosfato sódico monobásico, acetato de sodio, carbonato y bicarbonato sódicos, ácido clorhídrico, 4-aminotiofenol (4-ATP), cloruro de hexaamín rutenio (II) ([Ru(NH 3 ) 6 ]Cl 2 ) ferricianuro de potasio (K 3 [Fe(CN) 6 ]), ferrocianuro de potasio (K 4 [Fe(CN) 6 ]), 1-Etil-3-(3-dimetilaminopropil)carbodiimida (EDC), N-hidroxisuccinimida, β-nicotinamida adenín dinucleótido reducido (NADH), sulfato de hidrazina, borohidruro sódico (NaBH 4 ), hidrato de hidrazina, cloruro potásico, hidrógeno tetracloroaurato (HAuCl 4.3H 2 O), citrato sódico, peróxido de hidrógeno (H 2 O 2 ), lactato oxidasa (EC ), lactato de litio, ácido tartárico, ácido ascórbico, glucosa, tris(hidroximetil)aminometano (Tris), safranina, nitrato potásico (KNO 3 ). Otros reactivos han sido suministrados por Fluka: metanol, etanol, ácido acético glacial, acetato sódico, agua, ácido etilenglicol-bis(β-aminoetil éter)-n,n,n',n'- tetraacético (EGTA). El ácido sulfúrico fue proporcionado por Merck, la dimetilfomamida, por Fisher, la fructosa y el sulfato de zinc, por Panreac y el nitrito sódico por Riedel de Haën. Para todas las preparaciones en medio acuoso se utilizó agua purificada a través de un sistema de agua ultrapura Direct Q-3 UV de Millipore, que proporciona valores de resistividad de 18.2 MΩ/cm 2 a 25 ºC. Para desoxigenar las disoluciones, cuando fue necesario, se hizo pasar corriente de nitrógeno suministrado por Carburos Metálicos, S. A. El kit enzimático comercial para la determinación de lactato (K-LATE 07/14) se adquirió a Megazyme (Irlanda). 65

77 Materiales y métodos M.1.2 Reactivos sintetizados M Síntesis de 3,4-dihidroxisalophen La síntesis de N,N -bis(3,4-dihidroxibenciliden)-1,2-diaminobenceno (3,4-DHS) se llevó a cabo según el procedimiento descrito por Revenga-Parra [Revenga-Parra, 2005]. En un matraz de 25 ml se mezclaron 1.00 mmol de o-fenilendiamina ( g) y 2.00 mmol de 3,4-dihidroxibenzaldehído ( g). La mezcla sólida se molió a temperatura ambiente hasta conseguir un sólido finamente pulverizado. Posteriormente, la mezcla se calentó hasta 45ºC durante 60 minutos. Se obtuvo un sólido marrón que se recristalizó en metanol. M Síntesis de nanopuntos de carbono Los nanopuntos de carbono se sintetizaron mediante el método descrito por Ahmed [Ahmed, 2015]. Se disolvieron 2.00 mmol de ácido etilenglicol-bis(β-aminoetil éter)- N,N,N',N'-tetraacético (EGTA) ( g) en 30 ml de agua, formándose una suspensión blanca. Se añadieron 8.00 mmol de tris(hidroximetil)aminometano (Tris), obteniendo así una solución incolora. Se calentó en una placa a 150 ºC hasta casi sequedad donde se formó un gel amarillo pálido. Se añadió 1 ml de agua y se repitió el procedimiento 5 veces en unos 30 minutos. En ese momento se subió la temperatura a 180 ºC. Se continuó calentando hasta que el gel se volvió de un color naranja rojizo. El gel se disolvió en unos 25 ml de agua, se filtró a través de un filtro de nylon de 0.45 μm y la solución se purificó mediante diálisis a través de un tubo de diálisis (MWCO, 3.5 KDa) durante 3 días. La solución final se guardó a 4ºC hasta su uso. M.1.3 Disoluciones Las disoluciones tampón de fosfato se prepararon a partir de las especies correspondientes del sistema fosfórico-fosfato en función del ph requerido para cada una de ellas (3, 6-8). El valor del ph se ajustó con una disolución concentrada de NaOH. 66

78 Materiales y métodos La disolución tampón de acético/acetato 0.1 M a ph 5.0 se preparó a partir de ácido acético glacial y acetato sódico. El ph se ajustó con una disolución concentrada de NaOH. Las disoluciones tampón de carbonato ph 9.4 y 11.2 se prepararon a partir de las especies carbonato y bicarbonato sódico. El valor del ph se ajustó con una disolución concentrada de NaOH. Las disoluciones 3,4-dihidroxisalophen usadas en este trabajo (2.0 mm) se prepararon inmediatamente antes de ser utilizadas. Debido a la baja solubilidad del compuesto en medio acuoso, las disoluciones se prepararon en dimetilformamida. La disolución madre de hidrazina en concentración 1.0 x 10-2 M se preparó a partir del reactivo sólido en el tampón de medida. Las disoluciones de menor concentración se prepararon por dilución del volumen apropiado de las disoluciones madre con el tampón de medida. Las disoluciones de NADH 1.0 mm se prepararon a partir del sólido comercial en el tampón de trabajo. Estas disoluciones se prepararon inmediatamente antes de ser utilizadas. La disolución estándar de lactato 1.0 x 10-2 M se preparó a partir del sólido comercial en el tampón de trabajo. Esta disolución se preparó inmediatamente antes de ser utilizada. La disolución de hidróxido sódico 0.1 M se preparó en agua bidestilada a partir del sólido comercial. La disolución de ferrocianuro/ferricianuro potásico utilizada para las medidas de espectroscopía de impedancia electroquímica (EIS) y CV, se preparó disolviendo la cantidad necesaria de ferrocianuro y ferricianuro potásico para una concentración 5 mm en tampón fosfato ph 7 (0.1M) conteniendo cloruro potásico (KCl) en concentración 0.1 M. La disolución de [Ru(NH 3 ) 6 ] mm utilizada en la optimización del número de barridos de electroinjerto de MWCNTs se preparó a partir del sólido comercial en el tampón de trabajo. 67

79 Materiales y métodos La disolución de safranina 1.0 mm utilizada como indicador electroquímico del evento de hibridación se preparó a partir del reactivo sólido en tampón fosfato. M.1.4 Dispersiones M Dispersión de nanotubos de carbono no funcionalizados de pared múltiple (MWCNTs) o funcionalizados con grupos amina (MWCNT-NH 2 ) o con grupos carboxílicos (MWCNT-COOH) Se utilizaron nanotubos de carbono de pared múltiple no funcionalizados (MWCNTs), aminados (MWCNT-NH 2 ) o carboxilados (MWCNTs-COOH), (>95% pureza de carbón y <5% de impurezas de óxidos metálicos) suministrados por Nanocyl S.A. De acuerdo con las especificaciones del fabricante su diámetro es de 9.5 nm y su longitud media es de 1 μm, con un grado de funcionalización inferior al 0.5% para los grupos amino o carboxílicos. Se prepararon dispersiones madre de 0.5 mg ml -1 tanto de MWCNTs como de MWCNT-NH 2 en soluciones acuosas de SDS al 1% mediante sonicación durante 1 hora en un baño de ultrasonidos para conseguir la total homogeneidad de la dispersión. Antes de cada utilización se sonicó la dispersión durante 30 minutos. M Dispersión de grafeno oxidado (GO) El grafeno utilizado se sintetizó en el grupo de investigación mediante una modificación del método de Hummers [Casero, 2012; Hummers, 1958; Xu, 2008] y se caracterizó mediante diferentes técnicas (AFM, XPS, RAMAN), confirmando así que el material es grafeno oxidado. Se preparó una suspensión de concentración 1.0 mg ml -1 en tampón fosfato 0.1 M a ph 7.0. Previo a su utilización, la suspensión se sonicó al menos durante 30 minutos para separar los agregados formados por la interacción entre láminas de grafeno oxidado. La suspensión presenta color marrón oscuro. M.1.5 Muestras reales Las muestras de vino blanco, cerveza rubia tipo lager y yogur líquido probiótico se adquirieron en una tienda local. 68

80 Materiales y métodos M.1.6 Ácidos desoxirribonucleicos (ADN) Se utilizaron tres tipos de ácidos desoxirribonucleicos: ADN de timo de ternera, oligonucleótidos sintéticos y oligonucleótidos de muestras reales amplificados mediante la técnica de la reacción en cadena de la polimerasa (PCR). En todas las disoluciones de ADN se ha utilizado agua purificada a través de un sistema Direct Q-3 UV (Millipore) y esterilizada en autoclave. M ADN de timo de ternera El ADN de timo de ternera de cadena doble (ds-ctadn) fue suministrado por Sigma- Aldrich. Las disoluciones madre de ds-ctadn se prepararon en concentración 1 mg ml -1 en disolución tampón fosfato 0.1 M ph 7.0. La relación de absorbancias de la disolución de ADN a 260 nm y 280 nm (A 260 /A 280 ) fue de alrededor de 1.9, lo que indica que la disolución de ADN está libre de proteína [Marmur, 1961]. Se calculó la concentración en pares de bases del ADN utilizando un coeficiente de absortividad molar a 260 nm de 6600 M -1 [Doty, 1955]. El ADN de timo de ternera de cadena sencilla (ss-ctadn) se obtuvo calentando a 100 ºC en baño de agua viales cerrados que contenían ds-ctadn en tampón fosfato 0.1 M ph 7.0 durante 30 minutos. Para prevenir la renaturalización espontánea, la reacción se detuvo por la rápida inmersión en un baño de hielo. Las muestras desnaturalizadas se conservaron a -20 ºC. M Oligonucleótidos sintéticos Se emplearon oligonucleótidos sintéticos de cadena corta de 25 bases y de cadena larga de 100 bases, correspondientes a parte de una secuencia de la bacteria patógena Helicobacter pylori y del exón 11 del gen regulador transmembrana de la fibrosis quística, respectivamente. Estos oligonucleótidos fueron suministrados por Sigma-Aldrich. En el caso de la cadena de Helicobacter pylori, además de la sonda (HP1), se utilizaron secuencias sintéticas totalmente complementarias a la sonda (HP2C), una secuencia con una sola base no complementaria o polimorfismo de un solo nucleótido 69

81 Materiales y métodos (SNP) en el centro de la cadena (HP2SM) y, como control, una secuencia no complementaria (HP2NC). Estas secuencias se encuentran recogidas en la tabla M.1. Tabla M.1. Secuencias de oligonucleótidos sintéticos de cadena corta. Secuencias de oligonucleótidos sintéticos de 25 bases sonda 5'-GCGTTCCAAAGGGCAGGATCATTGA HP1 complementaria 5'-TCAATGATCCTGCCCTTTGGAACGC HP2C SNP 5'-TCAATGATCCTACCCTTTGGAAGCG HPSM no complementaria 5'-GACCGTCGAAGTAAAGGGTTCCATA HP2NC En el caso del gen regulador de la conductancia transmembrana de la fibrosis quística se empleó una sonda sintética (WT) de 100 bases, que corresponde a una secuencia del exón 11 de dicho gen complementaria a la secuencia de estirpe salvaje utilizada como analito. La secuencia de la sonda se recoge en la tabla M.2. Tabla M.2. Secuencias de oligonucleótidos sintéticos de cadena larga. Secuencias de oligonucleótidos sintéticos de 100 bases sonda 5' CTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATCTT TGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCC WTp Las disoluciones madre de oligonucleótidos se prepararon en concentración 100 µm en tampón fosfato 10.0 mm ph 7.0 con NaCl 0.4 M. Estas disoluciones se conservaron a -20 ºC en pequeñas alícuotas. M Oligonucleótidos de muestras reales amplificados mediante PCR Las muestras reales fueron suministradas por el grupo del Dr. Molano del Instituto de Genética Médica y Molecular de Madrid (INGEMM). El ADN genómico fue extraído de células sanguíneas de leucocitos de pacientes de fibrosis quística utilizando un kit comercial Purogene de Quiagen GmbH (Hilden, Alemania), siguiendo el 70

82 Materiales y métodos procedimiento descrito por García-Mendiola [García-Mendiola, 2014]. Las muestras de PCR son fragmentos de 373 pares de bases del exón 11 del gen regulador transmembrana de la fibrosis quística de individuos sanos (WT) o pacientes que presentan una mutación (mut). Como control se utilizó una secuencia no complementaria (NC) más corta. Las secuencias de PCR utilizadas se encuentran recogidas en la tabla M.3. Todas las muestras de ADN reales amplificadas por PCR son de cadena doble. Previamente a su utilización, para obtener ADN de cadena sencilla, las muestras se desnaturalizaron mediante calentamiento a 100ºC durante 30 minutos, seguido de un rápido enfriamiento en hielo. Todas las muestras se conservaron a -20 ºC. Tabla M.3. Secuencias de oligonucleótidos de muestras reales de PCR. Secuencias de oligonucleótidos de muestras reales de PCR estirpe salvaje mutada no complementaria 5 AACCGATTGAATATGGAGCCAAATATATAATTTGGGTAGTGTGAAGGGTTC ATATGCATAATCAAAAAGTTTTCACATAGTTTCTTACCTCTTCTAGTTGGCATG CTTTGATGACGCTTCTGTATCTATATTCATCATAGGAAACACCAAAGATGATAT TTTCTTTAATGGTGCCAGGCATAATCCAGGAAAACTGAGAACAGAATGAAATT CTTCCACTGTGCTTAATTTTACCCTCTGAAGGCTCCAGTTCTCCCATAATCAC CATTAGAAGTGAAGTCTGGAAATAAAACCCATCATTATTAGGTCATTATCAAAT CACGCTCAGGATTCACTTGCCTCCAATTATCATCCTAAGCAGAAGTGTATATTC 5 AACCGATTGAATATGGAGCCAAATATATAATTTGGGTAGTGTGAAGGGTTC ATATGCATAATCAAAAAGTTTTCACATAGTTTCTTACCTCTTCTAGTTGGCATG CTTTGATGACGCTTCTGTATCTATATTCATCATAGGAAACACCA ATGATAT TTTCTTTAATGGTGCCAGGCATAATCCAGGAAAACTGAGAACAGAATGAAATT CTTCCACTGTGCTTAATTTTACCCTCTGAAGGCTCCAGTTCTCCCATAATCAC CATTAGAAGTGAAGTCTGGAAATAAAACCCATCATTATTAGGTCATTATCAAAT CACGCTCAGGATTCACTTGCCTCCAATTATCATCCTAAGCAGAAGTGTATATTC 5 ACAGCTGAGTGCCCTGTCCTCAGATGGGGAGGGACAGGGTCGGCCTGTAC CCCGGAGGCACCTGGGTCCATCAGAGAAGGTGCAGGTGACAGAGGCGAAGG CAGATGGGGCACTGACCCAGGAGGAGAAAGCAGCCATTGGCACT WT mut NC 71

83 Materiales y métodos M.2. Instrumentación M.2.1 Espectrofotómetro Para las medidas de absorción espectrofotométrica se utilizó un espectrofotómetro PharmaSpec UV-1700 de SHIMADZU dotado con un sistema de termostatización de cubetas. Se utilizaron cubetas de cuarzo con 1 cm de paso óptico. M.2.2 Espectrofluorímetro Las medidas de emisión espectrofotométrica se realizaron en un espectrofluorímetro Cary Eclipse de Varian. Se utilizaron cubetas de cuarzo con 1 cm de paso óptico. M.2.3 Potenciostato Para llevar a cabo las medidas electroquímicas se utilizó un analizador electroquímico Autolab PGSTAT302N con módulo adicional de Espectroscopia de Impedancia Electroquímica FRA2 de EcoChemie con el software GPES 4.9. Se emplearon electrodos serigrafiados integrados (SPE) de DropSens S.L (Oviedo, España), que incluyen un electrodo de trabajo de oro o carbono, un pseudoreferencia de plata y un contraelectrodo del mismo material que el electrodo de trabajo. Los electrodos se conectaron mediante un conector SPE de DropSens. Para obtener el espectro de impedancia electroquímica se aplicó una onda sinusoidal de potencial de ± 10 mv de amplitud respecto al potencial de equilibrio del sistema redox (0.16 V vs. Ag) en un intervalo de frecuencias entre 10 5 y 5 x10-3 Hz, obteniendo 100 puntos distribuidos logarítmicamente. Los espectros obtenidos se analizaron mediante el ajuste de los resultados experimentales a un circuito equivalente utilizando el software GPES 4.9. M.2.4 Microscopio electrónico de barrido (SEM) Para las imágenes de SEM se utilizó un microscopio electrónico de barrido Philips XL30-FEG. 72

84 Materiales y métodos M.2.5 Microscopio de fuerzas atómicas (AFM) Las medidas de Microscopía de Fuerza Atómica (AFM) se llevaron a cabo en modo dinámico utilizando un sistema Nanotec Electrónica operado a temperatura y condiciones ambientales. Las imágenes se procesaron utilizando WSxM [Horcas, 2007]. Para las medidas de AFM se utilizaron cantilevers comerciales Olympus Si/N con una constante de fuerza nominal de 0.75 N M -1. Las superficies empleadas para estas medidas fueron sustratos de vidrio (1.1 cm 1.1 cm) recubiertos con una capa de cromo de 1-4 nm de espesor sobre la que se encontraba depositada una capa de oro de nm de espesor (Arrandee Co. Werther, Alemania). Antes de su uso, las superficies de oro se trataron durante 2 minutos con una llama para obtener terrazas de Au (111). Las medidas se llevaron a cabo en aire en modo de contacto intermitente. M.2.6 Espectrófotometro FTIR Las medidas de Espectroscopía de Infrarrojo con Transformada de Fourier (FTIR) se llevaron a cabo en un espectrómetro FT-IR Bruker IFS60v equipado con un detector MCT y sistema de purga de gas para la eliminación de CO 2 y H 2 O (Whatman). Los espectros se promediaron entre 1024 barridos con una resolución espectral de 2 cm -1. Para la sustracción del blanco y la corrección de línea base de espectros se utilizó el software OPUS de Bruker. M.2.7 Microscopio electrónico de transmisión (TEM) Las medidas de microscopía de transmisión electrónica (TEM) se realizaron en un microscopio electrónico JEOL JEM operado a 100kV. Para el análisis de las imágenes se utilizó el programa ImageJ 1.38x. Para otras medidas se utilizó un microscopio electrónico FEG S/TEM Talos F200X, FEI. 73

85 Materiales y métodos M.2.8 Espectrómetro Raman Las medidas de Espectroscopía Raman se realizaron en el Leibniz Institute of Photonic Technology (IPHT) y en el Institute of Physical Chemistry and Abbe Center of Photonics, Friedrich Schiller University, Jena (Alemania), utilizando diferentes espectrómetros micro-raman WITec equipados con distintos láseres: ión Argón a 488 nm, He-Ne a nm y diodo a 785nm. El procesado de datos incluye la sustracción de línea base descrita por Palacký [Palacký, 2011]. Las muestras se prepararon mediante deposición de 8 µl de una disolución de la sustancia en estudio sobre un sustrato de vidrio y secado a temperatura ambiente. M.2.9 Instrumentación para dispersión de luz dinámica (DLS) Las medidas de Dynamic Light Scattering (DLS) se realizaron a 25ºC utilizando un analizador de tamaño de partícula VASCO de Cordouan Technologies. M.2.10 Instrumentación para medida del potencial Zeta Las medidas de potencial Zeta se llevaron a cabo a 25 ºC utilizando un instrumento Zetasizer Nano ZS (Malvern Instrument Ltd., Grovewood, Worcestershire, Reino Unido). M.2.11 Instrumentación para análisis elemental Se utilizó un analizador elemental LECO CHNS-932, una balanza AD-4 Perkin-Elmer y una microbalanza MX5 Mettler Toledo. 74

86 Materiales y métodos M.3. Procedimientos experimentales M.3.1 Pretratamiento de los electrodos M Activación de electrodos serigrafiados de carbono Los electrodos serigrafiados de carbono se activaron en HCl 0.1M mediante la aplicación de 10 barridos cíclicos de potencial a 100 mv s -1 entre +0.5 y -1.0 V. A continuación, se aclararon con agua destilada. M Activación de electrodos serigrafiados de oro Los electrodos serigrafiados de oro se activaron en H 2 SO 4 0.1M mediante la aplicación de 10 barridos cíclicos de potencial a 100 mv s -1 entre -0.2 y +1.2 V. A continuación, se aclararon con agua destilada. M.3.2 Modificación de electrodos con nanotubos de carbono M Modificación de electrodos serigrafiados con MWCNTs aminados mediante diazotación y electroinjerto (estrategia 1) 100 μl de la disolución stock de MWCNTs-NH 2 (1mg ml -1 ) se mezclaron con 100 μl de NaNO 2 10 mm en agua y 10 μl de HCl 2 M. Esta mezcla se introdujo en un baño de hielo durante 10 minutos, ya que la reacción es exotérmica, con el objetivo de que la formación del diazoderivado fuera completa. Transcurrido este tiempo, se depositó sobre electrodos serigrafiados de oro (AuSPE) o carbono (CSPE) y se llevó a cabo el electroinjerto mediante la aplicación de 40 barridos cíclicos de potencial entre +0.6 V y -0.6 V a 100 mv s -1 para reducir la sal de diazonio generada in situ. Tras este proceso se aclararon con agua. 75

87 Materiales y métodos M Modificación de electrodos serigrafiados de oro con MWCNTs no modificados mediante diazotación y electroinjerto (estrategia 2) Los AuSPEs se sumergieron durante 1 hora en una disolución 1 mm de 4-aminotiofenol (4-ATP) en etanol para formar una monocapa autoensamblada sobre la superficie del oro de manera que los grupos amino queden expuestos. Posteriormente se aclararon con etanol y se secaron. Para diazotar los grupos amino, se cubrió el electrodo de trabajo con 7 μl de una disolución al 6% de NaNO 2 en HCl 1 M. Se dejó reaccionar durante 20 minutos a 4ºC. Una vez diazotados, los electrodos se secaron con N 2 y se cubrieron con una solución que contenía 100 μl de la disolución stock de MWCNTs (1mg ml -1 ) y 100μL de HCl 0.2 M en agua. Se aplicaron 60 barridos cíclicos entre +0.6 V y -0.6 V a 100 mv s -1 para injertar los CNTs a la superficie y, finalmente, se aclaró con agua. M Modificación de electrodos serigrafiados con MWCNTs por formación de un enlace triazeno (estrategia 3) Se sumergieron los AuSPEs durante 1 hora en una disolución 1 mm de 4-ATP en etanol. Posteriormente se aclararon con etanol y se secaron. Para diazotar los grupos amino, se cubrió el electrodo de trabajo (WE) con 7 μl de una disolución al 6% de NaNO 2 en HCl 1 M. Se dejó reaccionar durante 20 minutos a 4 ºC. Una vez diazotados, los electrodos se secaron con N 2, se cubrió el electrodo de trabajo con 15 μl de una solución de MWCNTs-NH mg ml -1 a ph 8 en NaOH y se dejó durante 2 horas a temperatura ambiente. Posteriormente se lavó con agua. M Modificación de electrodos serigrafiados con MWCNTs por formación de un enlace entre aminas y ácidos carboxílicos (estrategia 4) Se sumergieron los AuSPEs durante 1 hora en una disolución 1 mm de 4-ATP en etanol. Posteriormente se aclararon con etanol y se secaron. Tras la modificación con 4-ATP, se mezclaron 140 μl de agua, 20 μl de NHS (N-hidroxisuccinimida) 10 mm, 20 μl de EDC (1-etil-3-(3-dimetilaminopropil)carbodiimida) 10 mm y 20 μl de MWCNTs-COOH 0.5 mg ml -1, se agitó y se dejó reaccionar durante 1 minuto. Se 76

88 Materiales y métodos depositaron 7 μl de la mezcla sobre el electrodo de trabajo y se dejó durante 3 horas a 4 ºC en cámara húmeda. Se secó y se lavó con agua. M Modificación de electrodos serigrafiados con MWCNTs por adsorción directa (estrategia 5) Se depositaron sobre el electrodo de trabajo 4 μl de una mezcla 1:1 de la dispersión stock de CNTs-NH 2 y agua. Se llevó a sequedad y se lavó con agua. M.3.3 Modificación de las plataformas basadas en MWCNTs con 3,4-DHS Sobre los electrodos previamente modificados con MWCNTs se depositaron 3 μl de 3,4-DHS 1 mm en metanol sobre el electrodo de trabajo. Tras la evaporación del disolvente se lavó con agua para eliminar el material débilmente adsorbido. M.3.4 Síntesis de grafeno reducido con 3,4-DHS La síntesis se llevó a cabo mediante la mezcla de grafeno oxidado (GO) 20 μg ml -1 y 3,4-DHS 100 μm. Esta mezcla se calentó en baño de agua a 100 ºC durante 5 horas para permitir la reducción del grafeno. Pasado ese tiempo, la suspensión cambió de un color marrón a un color negro menos soluble. M.3.5 Reducción de grafeno oxidado con borohidruro sódico (NaBH 4 ) La reducción de GO con NaBH 4 se llevó a cabo siguiendo el procedimiento descrito por Shin y colaboradores [Shin, 2009]. A una suspensión de GO 20 μg ml -1 se le añadió NaBH mm. La reacción, que sucede de manera violenta, se dejó proceder durante 2 horas, tras las cuales, se centrifugó la suspensión a r.p.m. durante 30 minutos y se retiró el sobrenadante. M.3.6 Reducción de grafeno oxidado con hidrazina La reducción se llevó a cabo siguiendo el método descrito por Stankovich [Stankovich, 2007] con algunas modificaciones. En 5 ml de agua ultrapura se disolvieron 0.5 mg de GO y se dispersó mediante sonicación en un baño de 77

89 Materiales y métodos ultrasonidos. Se añadieron 12 μl de hidrato de hidrazina (160 μmol). La mezcla se calentó a reflujo durante 24 horas. Transcurrido este tiempo, se centrifugó la suspensión a r.p.m. durante 30 minutos y se retiró el sobrenadante. M.3.7 Modificación de electrodos con grafeno reducido químicamente Una vez llevado a cabo el tratamiento térmico de reducción, la suspensión de grafeno y 3,4-DHS se centrifugó a r.p.m. durante 40 minutos y se lavó dos veces con agua. Se retiró el sobrenadante hasta dejar un volumen de 30 µl. Se tomaron 8 μl del precipitado y se depositaron sobre electrodos serigrafiados de carbono (CSPE). M.3.8 Síntesis de nanopartículas de oro utilizando 3,4-DHS como reductor Las nanopartículas se sintetizaron mezclando en medio acuoso HAuCl μm y 3,4-DHS 100 μm. Esta mezcla se dejó reaccionar durante 24 horas protegida de la luz. Una vez formadas las nanopartículas (AuNPs-DHS) se purificaron mediante centrifugación a 9000 r.p.m. y lavados con agua para eliminar el exceso de 3,4-DHS y otros productos de reacción. M.3.9 Determinación del tamaño de las nanopartículas de oro El tamaño y concentración de las nanopartículas sintetizadas se determinó a partir del método descrito por Haiss y colaboradores [Haiss, 2007]. Este método se basa en la medida de las absorbancias a una longitud de onda de 450nm y a la longitud de onda correspondiente a la banda de máxima absorción de las nanopartículas sintetizadas. A partir del cociente entre ambas y utilizando una serie de tablas propuestas por Haiss se pudo estimar su tamaño, su coeficiente de extinción molar y, de este modo, su concentración. M.3.10 Modificación de electrodos con AuNPs-DHS Sobre la superficie del electrodo de trabajo de electrodos serigrafiados de carbono se depositaron 4 μl (70 fmol) de las nanopartículas sintetizadas. 78

90 Materiales y métodos M.3.11 Preparación del biosensor de lactato Se depositaron 5 μl (1U) de la enzima lactato oxidasa (LOx) sobre los electrodos serigrafiados de carbono previamente modificados con los nanomateriales. Se mantuvieron durante 1 hora a 4 ºC para la inmovilización de la proteína sobre la superficie del electrodo. M.3.12 Determinación de lactato mediante el kit enzimático La cantidad de lactato presente en las muestras se determinó espectrofotométricamente siguiendo las instrucciones del fabricante (Megazyme). A la muestra diluida en el tampón de medida se le añadieron NAD + y la enzima D- glutamato-piruvato transaminasa (D-GTP). Tras 3 minutos de estabilización, se anotó la absorbancia a 340 nm (A 1 ). Se le añadió lactato deshidrogenasa (L-LDH) y se anotó la absorbancia pasados 10 minutos (A 2 ). La concentración de lactato se calculó según la ecuación: c = V MW ε d v (A 2 A 1 ) donde V es el volumen final, MW, la masa molecular del ácido láctico (90.1 g mol -1 ), ε, el coeficiente de extinción molar del NADH a 340 nm (6300 M -1 cm -1 ), d, el paso óptico de la celda espectrofotométrica (1 cm) y v, el volumen de la muestra. Además de la dilución, las muestras de cerveza fueron desgasificadas previamente y las muestras de yogur se sometieron a un pretratamiento para su clarificación. En un matraz aforado de 50 ml se depositaron 0.5 ml de yogur líquido. Se añadieron 1 ml de K 4 [Fe(CN) 6 ].3H 2 O M (reactivo de Carrez I), 1 ml de ZnSO 4.7H 2 O (reactivo de Carrez II) y 2 ml de NaOH 0.1 M. Se enrasó con agua y se filtró. M.3.13 Estimación de la concentración de CNDs Teniendo en cuenta la masa de reactivos en la pesada inicial y el porcentaje de carbono presente, obtenido mediante análisis elemental, se estimó la cantidad total de carbono en la muestra. A partir de la relación de volúmenes del carbono y de los nanopuntos sintetizados (calculado a partir del diámetro de las partículas obtenido por 79

91 Materiales y métodos DLS) se obtuvo el número de átomos de carbono que forman cada nanopunto y el número de total de nanopuntos. Se estimó una concentración de CNDs de 277 µm. M.3.14 Modificación de electrodos con CNDs Se depositaron 5 µl de una dispersión 3.5 µm de CNDs sobre la superficie del electrodo de trabajo de electrodos serigrafiados de oro y se dejaron secar al aire a temperatura ambiente durante 24 horas. M.3.15 Inmovilización de ADN sobre los electrodos nanoestructurados Sobre los electrodos nanoestructurados con CNDs se depositaron 10 µl de una disolución 2.0 mm de ADN de cadena sencilla o doble. Tras la evaporación del disolvente se lavó con agua esterilizada durante 30 minutos para eliminar el ADN débilmente adsorbido. M.3.16 Preparación del biosensor de ADN Se depositaron 10 µl de disoluciones 40 µm de las secuencias sintéticas de captura (HP1, WT) sobre los electrodos nanoestructurados con CNDs. El electrodo se mantuvo a temperatura ambiente durante 24 horas y se lavó con agua esterilizada durante 30 minutos. M.3.17 Desnaturalización de las muestras de ADN de PCR Las muestras obtenidas mediante PCR se desnaturalizaron inmediatamente antes de su utilización por calentamiento en baño de agua a 100 ºC durante 20 minutos seguido de un enfriamiento rápido en baño de hielo [Pang, 1995]. M.3.18 Hibridación de ADN en el biosensor Sobre el biosensor preparado por nanoestructuración de AuSPE con CNDs y modificación con la sonda de ADN de captura se depositaron 10 µl de una disolución de la secuencia analito de concentración 20 µm para los oligonucleótidos sintéticos y 5.0 ng µl -1 para las muestras de PCR desnaturalizadas. 80

92 Materiales y métodos M.3.19 Detección del evento de hibridación en el biosensor de ADN Tras la hibridación de la secuencia analito con la sonda en la superficie del electrodo, los electrodos modificados con ADN se sumergieron en una disolución de safranina 1.0 mm en tampón fosfato 0.1 M ph 7.0 y se aplicaron 100 barridos cíclicos de potencial a 100 mv s -1. Posteriormente, los electrodos se aclararon con agua esterilizada y se registraron los voltamperogramas de diferencial de impulsos (DPV) en tampón fosfato 0.1 M ph 7.0. M.3.20 Determinación de la temperatura de desnaturalización (T m ) Las curvas de para la determinación de la temperatura de desnaturalización se realizaron por representación de la absorbancia a 260 nm de disoluciones de ADN en concentración 60 µm frente a la temperatura en la cubeta. Las medidas se llevaron a cabo en tampón fosfato 0.1 M ph 7.0. Para el control de la temperatura, el espectrofotómetro se conectó a un baño termostatizado y la variación de la temperatura se realizó entre 30 y 90 ºC a una velocidad de 1 ºC min -1. M.4. Cálculo de parámetros y constantes de interés M.4.1 Determinación del área del electrodo electroquímicamente activa El área electroquímica de los electrodos se estimó utilizando la ecuación: Q = 2n F C D 1/2 t 1/2 π -1/2 A (1) donde Q es la carga pasada en función del tiempo, n es el número de electrones implicados en el proceso, F es la constante de Faraday, C es la concentración del mediador, D es el coeficiente de difusión, t es el tiempo transcurrido y A es el área electroquímica [Bard, 2001]. Q se estimó mediante cronocolumbimetría a +0.4 V en K 3 [Fe(CN) 6 ] 5 mm disuelto en tampón fosfato 0.1 M ph7.0 con KCl 1 M. 81

93 Materiales y métodos M.4.2 Recubrimiento superficial del material depositado sobre la superficie del electrodo El recubrimiento superficial del material depositado sobre las diferentes superficies electródicas se ha estimado a partir de la integración del área de la onda anódica de los correspondientes voltamperogramas cíclicos de los electrodos modificados, a partir de la siguiente expresión: Γ = Q n F A (2) donde Q es la carga obtenida por integración del pico anódico, n el número de electrones implicados en el proceso, F la constante de Faraday (C mol -1 ) y A el área electroactiva del electrodo de trabajo (cm 2 ). M.4.3 Constante heterogénea de transferencia de carga. Especies inmovilizadas sobre la superficie del electrodo Se ha calculado la constante heterogénea de transferencia de carga (ks) entre el mediador redox inmovilizado y la superficie electródica mediante voltamperometría cíclica utilizando el método descrito por Laviron [Laviron, 1979]. Este establece que cuando la diferencia de potencial de pico anódico y catódico supera el valor correspondiente a 200/n mv, es posible calcular el coeficiente de transferencia de carga (α), así como la constante heterogénea de transferencia de carga (ks) para el sistema sometido a estudio, utilizando para ello las ecuaciones siguientes: E pa = E RT αnf E pa = E 0 2.3RT (1 α)nf log v (3) log v (4) log k s = α log(1 α) + (1 α) log α log RT nf E pα(1 α) nfv 2.3RT (5) El coeficiente de transferencia de carga (α) se calcula gráficamente. Para ello, se representan los potenciales de pico anódico y catódico frente al logaritmo de la velocidad de barrido, obteniéndose dos curvas asintóticas respecto al potencial formal 82

94 Materiales y métodos del sistema. Cuando se supera el valor de 200/n, propuesto por Laviron, se puede obtener el coeficiente α mediante las ecuaciones (3) y (4) de la intersección de las pendientes de las rectas con el potencial formal. La constante heterogénea de transferencia de carga (ks) se calcula a partir de la ecuación (5). M.4.4 Constante catalítica mediante el método de Galus La constante catalítica de procesos electrocatalíticos con electrodos modificados se estimó mediante cronoamperometría de un solo pulso en función de la concentración de sustrato, según el método descrito por Galus [Galus, 1991]. Este procedimiento se basa en la ecuación: I CAT /I D =γ 1/2 [ 1/2 erf(γ 1/2 )+exp(-γ)/γ 1/2 ] (6) donde la relación I CAT /I D, se define como la eficiencia catalítica del electrodo modificado, expresada como la respuesta del mismo en presencia (I CAT ) y en ausencia (I D ) de la sustancia electrocatalizada, γ es el argumento de la función de error, descrita como γ=kc*t, donde C* es la concentración de la sustancia electrocatalizada (mol/l) en el seno de la disolución y k es la constante catalítica. En el caso de que γ supere el valor de 2, la función de error es casi igual a 1 y la ecuación anterior se puede simplificar a: I CAT /I D = 1/2 γ 1/2 =( kc*t) 1/2 (7) donde t es el tiempo transcurrido en segundos. La representación de I CAT /I D respecto a la raíz cuadrada del tiempo de muestreo (t 1/2 ) para las distintas concentraciones de la especie electroactiva da lugar a diferentes rectas. De la representación de las pendientes de estas rectas frente a C 1/2 se obtiene otra recta, cuya pendiente permite estimar la constante catalítica (k), expresada en M -1 s -1, de acuerdo con la ecuación (7). M.4.5 Coeficiente de difusión El coeficiente de difusión para especies en disolución se ha estimado mediante cronoamperometría de un solo pulso en función de la concentración de la especie, utilizando para ello la ecuación de Cottrell para un electrodo plano: 83

95 Materiales y métodos I = nfac 0 D πt (8) donde I es la corriente límite de difusión (A), n es el número de electrones transferidos, F es la constante de Faraday, A es el área de trabajo (cm -1 ), C 0 es la concentración (mol cm -3 ), t es el tiempo de muestreo (s) y D es el coeficiente de difusión (cm 2 s -1 ). La representación de la corriente límite de difusión frente al inverso de la raíz cuadrada del tiempo de muestreo (t -1/2 ) para las distintas concentraciones de la especie estudiada es una línea recta. De la representación de las pendientes de esta recta frente a C 0 se obtiene una recta, cuya pendiente permite estimar el coeficiente de difusión (D), de acuerdo con la ecuación (8). M.4.6 Deconvolución de bandas Para la deconvolución de las bandas de los espectros Raman se utilizó el programa Microsoft Excel con el complemento Solver. Todas las bandas se ajustaron a una función Lorentziana, excepto en la banda G, para la que se usó una función Breit- Wignar-Fano (BWF) [Ferrari, 2000]. La expresión de la función Lorentziana se muestra en la ecuación (9). L(x) = 1 π σ (9) (x μ) 2 +(σ) 2 donde μ es el centro de la curva y σ es la anchura de la banda. La función BWF se expresa como: BWF(x) = A(qσ 2 +x μ)2 ( σ 2 )2 +(x μ) 2 (10) donde μ es el centro de la curva, σ es la anchura de la banda y q es el parámetro de Fano. 84

96 Resultados y discusión

97

98 Capítulo 1

99

100 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio 1. Plataformas electrocatalíticas basadas en nanotubos de carbono y en la química de las sales de diazonio El objetivo perseguido en este capítulo es la construcción de plataformas electrocatalíticas mediante la nanoestructuración de electrodos para su aplicación en el desarrollo de sensores. El nanomaterial utilizado en este caso son los nanotubos de carbono de pared múltiple (MWCNTs). Con el propósito de conseguir plataformas nanoestructuradas estables, se han estudiado diferentes estrategias de inmovilización de los MWCNTs basadas en las sales de diazonio. Las sales de diazonio son compuestos que presentan en su estructura el grupo diazonio (NΞN + -R). Su formación se basa en la reacción de una amina aromática con nitrito sódico en medio ácido, en el proceso conocido como diazotación, tal como se describe en la introducción de esta memoria. Las sales de arildiazonio en disolución son relativamente estables en medio ácido, baja temperatura y protegidas de la luz. Debido a su alta reactividad y al gran rendimiento que se obtiene en los procesos que participan se utilizan como intermedios de reacción en la síntesis de fenoles, haluros y nitrilos, entre otros. La reducción electroquímica de las sales de diazonio genera un radical arilo que se une covalentemente a la superficie del electrodo en el proceso de electroinjerto. La utilización de nanotubos de carbono derivatizados con grupos amina (MWCNTs-NH 2 ) permite la unión covalente de estos al electrodo. De esta manera, las plataformas desarrolladas serán más estables. En concreto, en este capítulo se han desarrollado plataformas electrocatalíticas frente a la oxidación de NADH e hidrazina mediante la nanoestructuración de electrodos serigrafiados (SPE) con MWCNTs. Se estudiaron diferentes estrategias para la inmovilización de los MWCNTs sobre los electrodos. Las plataformas nanoestructuradas se modificaron posteriormente con 3,4-DHS para mejorar sus propiedades electrocatalíticas. 89

101 Resultados y discusión. Capítulo Inmovilización de los MWCNTs sobre los electrodos La nanoestructuración de los electrodos serigrafiados con MWCNTs aminados y no aminados se llevó a cabo mediante distintas estrategias, tres de ellas basadas en la química de las sales de diazonio, otra, en la reacción de condensación de aminas y ácidos carboxílicos y una quinta, de forma más sencilla, por adsorción directa, que sirve a modo de comparación. La dispersión de los nanotubos de carbono de pared múltiple previa a su utilización, se realizó mediante la combinación de dos métodos, la utilización de un surfactante aniónico, el SDS, y un baño de ultrasonidos Nanoestructuración de los electrodos según la estrategia 1 La estrategia 1 consistió en la diazotación y electroinjerto de nanotubos de carbono aminados sobre los electrodos serigrafiados. La diazotación de los grupos amina presentes en los MWCNTs se llevó a cabo según se muestra en la figura 1.1, como se describe en la sección de materiales y métodos. Una vez formada la sal de diazonio, se llevó a cabo el electroinjerto de los nanotubos diazotados sobre los electrodos serigrafiados de oro (AuSPEs) o carbono (CSPEs) aplicando barridos cíclicos de potencial entre +0.6V y -0.6V a 100 mv s -1. N NH 2 2 NaNO 2 /HCl N 2 + DIAZOTACIÓN ELECTRORREDUCCIÓN N 2 + Fig Esquema de la estrategia 1 de nanoestructuración de electrodos. En la figura 1.2 se muestran los voltamperogramas cíclicos correspondientes al proceso de electroinjerto de los MWCNTs-NH2 sobre los electrodos serigrafiados de carbono. En el primer barrido de electroinjerto de los MWCNTs-NH2 diazotados (fig. 1.2A) se observa un solo pico a V en el barrido catódico, que se adscribe a la reducción del grupo diazonio, como se confirma por la ausencia de pico en la figura 1.2B, donde los MWCNTs-NH 2 no han sido previamente diazotados. 90

102 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio 0 A 0 I ( A) -100 I ( A) B E (V) E (V) Fig Voltamperogramas cíclicos del proceso de electroinjerto sobre CSPEs de MWCNTs-NH 2 diazotados (A) y sin diazotar (B) en medio HCl 0.1 M. Velocidad de barrido 100 mv s -1. Durante el proceso de electroinjerto se forma un radical arilo, que forma un enlace covalente con la superficie. Este radical puede reaccionar con otros nanotubos ya injertados, formando multicapas de CNTs sobre la superficie del electrodo [Kariuki, 2001; Laforgue, 2005]. Con objeto de establecer si la cantidad de MWCNTs injertados en la superficie es dependiente del número de barridos de potencial aplicados se estudió la influencia de este factor en las propiedades electroquímicas de los electrodos nanoestructurados preparados. Para ello se utilizó una sonda electroquímica, el [Ru(NH 3 ) 6 ] mm en tampón fosfato (PB) 0.1 M ph 7.0 y se estudió la respuesta ciclovoltamperométrica de los distintos electrodos preparados. 91

103 I ( A) I ( A) Resultados y discusión. Capítulo A 60 B E (V) E (V) Fig Voltamperogramas cíclicos en [Ru(NH 3 ) 6 ] mm en tampón fosfato (PB) 0.1 M ph 7.0 antes ( ) y tras la nanoestructuración con MWCNTs aplicando 10 ( ), 40 ( ) y 60 ( ) barridos en el proceso de electroinjerto en la estrategia 1 para CSPEs (A) y AuSPEs (B) 100 mv s -1. En la figura 1.3 se muestran los voltamperogramas cíclicos obtenidos con electrodos serigrafiados de carbono u oro nanoestructurados mediante la estrategia 1 aplicando 10, 40 y 60 barridos cíclicos de potencial, así como del electrodo no nanoestructurado, en presencia de [Ru(NH 3 ) 6 ] +3. En el caso de los electrodos serigrafiados de carbono (figura 1.3A) se observa un aumento considerable de la señal del electrodo nanoestructurado con respecto al electrodo sin nanoestructurar, probablemente debido a un aumento en el área electroactiva y de la transferencia de carga en presencia de los nanotubos inmovilizados. La respuesta aumenta con el número de barridos hasta 40. Al seguir aumentando la cantidad de nanomaterial sobre la superficie del electrodo se aprecia una disminución en la respuesta electroquímica, probablemente debido a la formación de multicapas de MWCNTs, que dificultan la difusión de la sonda a la superficie del electrodo. Por este motivo se eligió 40 como el número óptimo de barridos para llevar a cabo el proceso de electroinjerto. En el caso de los electrodos serigrafiados de oro (figura 1.3B) se observa la misma tendencia que en carbono, obteniéndose la mayor intensidad para 40 barridos de electroinjerto. Sin embargo, en este caso, la presencia de nanotubos produce una mejora más modesta de la respuesta electroquímica de la sonda al compararla con la 92

104 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio del electrodo sin nanoestructurar. Este hecho sugiere que el proceso de electroinjerto de los MWCNTs diazotados es menos eficiente sobre electrodos de oro que sobre los de carbono Nanoestructuración de los electrodos según la estrategia 2 La estrategia 2 de inmovilización de los nanotubos de carbono sobre los electrodos serigrafiados está también basada en la química de las sales de diazonio. En este caso, se utilizaron MWCNTs no modificados. Sobre ellos se electroinjertaron las sales de diazonio generadas sobre la superficie del electrodo, según el esquema de la figura 1.4. Para ello, se modificó la superficie del electrodo de oro con 4-aminotiofenol (4-ATP). Los tioles tienen una gran afinidad por el oro [Dubois, 1992] y se unen a él formando una monocapa autoensamblada (SAM) [Ulman, 1996]. La quimisorción de tioles sobre el oro es una adición oxidativa del enlace S-H a la superficie del oro, seguida de una eliminación por reducción de hidrógeno, según la reacción: R-S-H + Au R-S-Au + ½ H 2 La formación de la SAM de 4-ATP sobre la superficie del electrodo deja esta recubierta con grupos amino expuestos hacia la disolución, sobre los que se pueden generar sales de diazonio. La reacción de diazotación se llevó a cabo como se describe en la sección de materiales y métodos. El proceso de electroinjerto se realizó cubriendo el electrodo con una disolución de MWCNTs en ácido clorhídrico 0.1 M y mediante la aplicación de barridos cíclicos de potencial entre +0.6V y -0.6V a 100 mv s -1 para injertar los MWCNTs a la superficie. NaNO 2 /HCl N 2 AuSPE 4-ATP DIAZOTACIÓN ELECTRORREDUCCIÓN Fig Esquema de la estrategia 2 de nanoestructuración de electrodos Como se ha comentado anteriormente, la cantidad de MWCNTs electroinjertados sobre la superficie del electrodo depende del número de barridos de electroinjerto, por 93

105 I ( A) Resultados y discusión. Capítulo 1 lo que se estudió la influencia de este parámetro en la respuesta electroquímica de los electrodos nanoestructurados, utilizando voltamperometría cíclica en presencia de [Ru(NH 3 ) 6 ] +3 en tampón fosfato 0.1 M ph E (V) Fig Voltamperogramas cíclicos en [Ru(NH 3 ) 6 ] +3 en tampón fosfato 0.1 M ph 7.0 antes ( ) y tras la nanoestructuración con MWCNTs aplicando 10 ( ), 40 ( ) y 60 ( ) barridos en el proceso de electroinjerto en la estrategia 2 para AuSPEs a 100 mv s -1. En la figura 1.5 se muestran los voltamperogramas cíclicos de electrodos serigrafiados de oro nanoestructurados mediante la estrategia 2 aplicando 10, 40 y 60 barridos cíclicos de potencial, así como del electrodo no nanoestructurado, en presencia de [Ru(NH 3 ) 6 ] +3. Cuando los AuSPEs se modifican empleando la estrategia 2, el aumento de la señal electroquímica con el número de barridos es más pequeño que cuando se emplea la estrategia 1. Este hecho se puede explicar teniendo en cuenta el fundamento de las diferentes estrategias empleadas, ya que en la estrategia 1 los MWCNTs-NH 2 se diazotan y se unen covalentemente a la superficie de los electrodos, mientras que en la estrategia 2, se unen covalentemente MWCNTs no modificados a los grupos amino diazotados presentes en el 4-ATP que modifica la superficie de AuSPE. Obviamente, el número y la accesibilidad de los grupos amino disponibles para unir los MWCNTs a la superficie del electrodo son diferentes en ambas estrategias, por lo que el tiempo requerido para el proceso de electroinjerto es diferente. En este caso, la mayor señal se obtiene para 60 barridos, por lo que se eligió 60 como el número óptimo de barridos de electroinjerto en la estrategia 2. 94

106 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Nanoestructuración de los electrodos según la estrategia 3 La estrategia 3 también se basa en la química de las sales de diazonio y en la modificación previa de la superficie del electrodo con una monocapa autoensamblada de 4-ATP como en la estrategia 2, en este caso, en la formación de un enlace triazeno. [Norman, 1993]. El enlace triazeno, también llamado diazoaminobenceno, se forma por el ataque nucleofílico del nitrógeno de la amina al nitrógeno terminal del catión diazo, como se muestra en el esquema de la figura 1.6. N + N + H 2 N : -H 2 O + - H 3 O N N NH Fig Esquema de formación del enlace triazeno. Tras la modificación con 4-ATP, los grupos amino presentes en la superficie se diazotaron de la misma manera que en la estrategia 2 y los MWCNTs-NH 2 se unieron a la superficie mediante la formación de un enlace triazeno en medio básico, según se muestra en el esquema de la figura 1.7. NH 2 NH 2 + N + + NH NH 2 N N N N N N SH S S S NaNO 2 /HCl S S S S S AuSPE 4-ATP DIAZOTACIÓN ph 8 Fig. 1.7 Esquema de la estrategia 3 de nanoestructuración de electrodos Nanoestructuración de los electrodos según la estrategia 4 Para la nanoestructuración según la estrategia 4 se utilizaron nanotubos modificados con grupos carboxílicos (MWCNTs-COOH) y, al igual que en la anterior, electrodos modificados previamente con una monocapa de 4-ATP. En este caso se trata de formar un enlace amida entre las aminas del 4-ATP y los grupos carboxílicos de los MWCNTs-COOH, mediante reacción entre carbodiimida (EDC, 1-etil-3-(3-95

107 Resultados y discusión. Capítulo 1 dimetilaminopropil)carbodiimida) e hidroxisuccinimida (NHS, N-hidroxisuccinimida), como se muestra en el esquema de la figura 1.8. NH NH AuSPE 4-ATP EDC/NHS Fig. 1.8 Esquema de la estrategia 4 de nanoestructuración de electrodos Nanoestructuración de los electrodos según la estrategia 5 A modo de comparación y para comprobar la eficiencia de la nanoestructuración covalente, se estudió la estrategia 5, que consiste en la adsorción directa de los MWCNTs-NH 2 sobre la superficie de los electrodos serigrafiados, tanto de oro como de carbono, tal como se muestra en el esquema de la figura 1.9. AuSPE CSPE MWCNTs Fig. 1.9 Esquema de la estrategia 5 de nanoestructuración de electrodos. 1.2 Caracterización de los electrodos nanoestructurados con nanotubos de carbono Con el objetivo de constatar la presencia y estudiar la distribución de los MWCNTs sobre los electrodos nanoestructurados mediante las diferentes estrategias, estos se caracterizaron mediante técnicas de caracterización de superficies como la microscopía electrónica de barrido (SEM) o la microscopía de fuerzas atómicas (AFM), así como mediante voltamperometría cíclica en presencia de una sonda electroquímica. 96

108 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Caracterización de los electrodos nanoestructurados mediante microscopía electrónica de barrido (SEM) La microscopía electrónica de barrido (SEM) es una técnica que permite estudiar la morfología y composición de una superficie. Se basa en el análisis de los electrones retrodispersados o secundarios emitidos al incidir sobre la muestra un haz de electrones. Los electrodos nanoestructurados se caracterizaron mediante SEM, siendo así posible distinguir la distribución de los MWCNTs sobre la superficie de aquellos. En la figura 1.10 se muestran las imágenes obtenidas para AuSPEs nanoestructurados siguiendo las diferentes estrategias propuestas. Los electrodos serigrafiados (A) presentan una estructura granular en la que los granos de oro se encuentran unidos entre sí por un polímero conductor. Tras la nanoestructuración, se pueden apreciar los MWCNTs cubriendo los electrodos. Cuando se utilizan las estrategias basadas en diazotación y electroinjerto de las sales de diazonio (B y C), se observa una menor cantidad de nanotubos sobre la superficie al comparar con la adsorción directa (F). En el caso de las modificaciones basadas en la formación de las sales de diazonio (estrategias 1 y 2) se puede apreciar una cobertura similar a un velo cubriendo las estructuras granulares de la superficie del electrodo, sin embargo aún es posible distinguir la estructura rugosa inferior. La adsorción directa de los MWCNTs (estrategia 5) sobre la superficie del electrodo (F) da lugar a una cobertura mucho mayor. En este caso, la imagen es similar a las anteriores, sin embargo, las estructuras granulares ya no son tan nítidas como en el caso de las estrategias basadas en las sales de diazonio. De hecho, la imagen está ligeramente borrosa, pero las diferencias de densidad son claras. Cuando los AuSPEs se modifican mediante las estrategias 3 y 4 (D y E) no se pueden apreciar los nanotubos en la superficie, es decir, la estrategia de inmovilización no resulta muy efectiva. 97

109 Resultados y discusión. Capítulo 1 A B C D E F Fig Imágenes de SEM de los AuSPEs no nanoestructurados (A) y nanoestructurados según las diferentes estrategias: (B) estrategia 1, (C) estrategia 2, (D) estrategia 3, (E) estrategia 4 y (F) estrategia 5. En el caso de los CSPEs (figura 1.11) no parece haber diferencias sustanciales con respecto a los AuSPEs, se observa la misma tendencia. Los electrodos no nanoestructurados (A) presentan también una estructura granular, aunque en este caso el tamaño de grano es menor. La nanoestructuración con los MWCNTs mediante diazotación y electroinjerto, estrategia 1 (B), da lugar a un recubrimiento 98

110 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio superficial inferior a la adsorción directa (estrategia 5) (C), lo que sugiere que estos electrodos muestran una mayor área electroactiva para una misma área geométrica. En este caso, se pueden observar incluso ovillos de MWCNTs, lo que hace que los electrodos nanoestructurados mediante adsorción directa sean menos reproducibles. A B C Fig Imágenes de SEM de los CSPEs no nanoestructurados (A) y nanoestructurados mediante las estrategias: 1 (B) y 5 (C) Caracterización de los electrodos nanoestructurados mediante microscopía de fuerzas atómicas (AFM) La microscopía de fuerzas atómicas (AFM) es una técnica que permite registrar la imagen topográfica de una superficie mediante la interacción de esta con una sonda piramidal llamada cantilever, que va acoplada a una palanca flexible. Con el fin de conocer la disposición de los MWCNTs sobre los electrodos, se estudió su superficie utilizando AFM. Debido a la naturaleza granular de los electrodos serigrafiados, en lugar de estos se utilizaron placas de vidrio recubiertas con una capa fina de oro, previamente calentadas para conseguir terrazas de oro (111). 99

111 Z[nm] Resultados y discusión. Capítulo 1 Como se comentó anteriormente, la funcionalización de los nanomateriales de carbono tiene lugar preferentemente en las zonas que presentan defectos, lo que en el caso de los nanotubos son los extremos abiertos. Por este motivo, se espera que los grupos amino presentes en los MWCNTS-NH 2 que se utilizan en la estrategia 1, se encuentren principalmente en los extremos. Si esto es así, tras la diazotación y electroinjerto, los MWCNTs deberían encontrarse formando un ángulo sobre la superficie. Existen ejemplos en la bibliografía de nanotubos dispuestos de forma perpendicular a la superficie [Diao, 2002; Gooding, 2003; Liu, 2000; Diao, 2010]. En estos ejemplos los CNTs tienen un tamaño inferior a 200 nm. A B 40 C X[µm] 1.5 Fig Imágenes de AFM (A, B) y perfil (C) de una lámina de oro modificada con MWCNTs mediante la estrategia 1. En la figura 1.12 se muestran las imágenes (A, B) y perfil (C) de los MWCNTs depositados sobre la superficie de oro mediante la estrategia 1. En las imágenes (A, B) se puede observar que los MWCNTs inmovilizados se encuentran tumbados y homogéneamente distribuidos. Sin embargo, el perfil (C) que corresponde a la figura 1.12B muestra alturas en torno a 20 nm. Este valor es superior al diámetro proporcionado por la casa comercial de 9.5 nm, por lo que, aunque los MWCNTs utilizados son demasiado largos para obtener una perpendicularidad perfecta (alrededor de 1 μm), la inmovilización mediante la estrategia 1 puede dar lugar a algún tipo de verticalidad en la parte cercana a la superficie del electrodo, como se muestra en la figura

112 Z[nm] Z[nm] Z[nm] Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Fig Esquema de la alineación de los MWCNTs sobre la superficie modificada según la estrategia 1. En la figura 1.14 se muestran las imágenes (A, B) y los perfiles (C-E) de las superficies modificadas mediante la estrategia 5. En este caso, resultaron más difíciles de obtener debido a la presencia de gran cantidad de material, por lo que fue necesario tomar la imagen en el borde de la superficie para poder distinguir las características de los agregados de tamaño nanométrico. En las imágenes (A, B) se pueden ver los MWCNTs formando un lecho sobre la superficie. Los perfiles (C-E) muestran un perfil de alturas poco homogéneo, con zonas más y menos pobladas. Estos resultados confirman la heterogeneidad de la distribución de los MWCNTs inmovilizados mediante la estrategia 5. A B C D 50 E X[µm] X[µm] X[µm] Fig Imágenes de AFM (A, B) y perfiles (C, D, F) de una lámina de oro modificada con MWCNTs mediante la estrategia

113 Resultados y discusión. Capítulo Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica En los nanotubos de carbono, existen dos regiones superficiales con distintas propiedades, las paredes y los extremos. Dependiendo de la orientación de estos sobre el electrodo, la electroquímica estará dominada por una de las dos regiones. La velocidad de transferencia de carga para los CNTs depende de la superficie. Los extremos de los CNTs se asemejan a los bordes del grafito pirolítico con excelentes propiedades de transferencia electrónica, mientras que las paredes se comparan con los planos basales del grafito, con una cinética de transferencia electrónica mucho más lenta [Li, 2002]. Nugent describió [Nugent, 2001] el comportamiento electroquímico de la sonda redox [Fe(CN) 6 ] 4-/3- en grafito pirolítico. La separación de picos del voltamperograma (ΔE p ) en los planos basales presenta una separación diez veces mayor que en los bordes, indicando que la transferencia electrónica es mucho más rápida en los bordes. Gooding y colaboradores [Gooding, 2005] describieron un comportamiento similar en el caso de los nanotubos de carbono. En este caso, cuando los nanotubos de carbono de pared sencilla (SWCNTs) se encuentran dispuestos de forma perpendicular a la superficie se observa menor ΔE p que cuando los nanotubos se adsorben directamente sobre la superficie del electrodo formando un lecho. La presencia de defectos en la superficie de los nanotubos aumenta considerablemente la velocidad de transferencia electrónica [Pumera, 2008], sin embargo, se ha demostrado que la presencia de grupos oxigenados hace que disminuya [Banks, 2006]. Para investigar el comportamiento de las plataformas obtenidas por nanoestructuración con nanotubos mediante las diferentes estrategias, se estudió el comportamiento del par redox [Fe(CN) 6 ] 4-/3- en dichas plataformas. 102

114 I ( A) Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio E (V) Fig Voltamperogramas cíclicos de AuSPEs antes ( ) y tras la nanoestructuración según la estrategia 1 ( ), estrategia 2 ( ) y estrategia 5 ( ) en tampón fosfato 0.1 M ph 7.0 en presencia de K 3 [Fe(CN) 6 ] 5 mm a 100 mv s -1. En la figura 1.15 se muestran los voltamperogramas cíclicos de AuSPEs nanoestructurados mediante las estrategias 1, 2 y 5. En todos los casos, el voltamperograma presenta un pico catódico y uno anódico bien definidos debidos al par de [Fe(CN) 6 ] 4-/3-, lo que sugiere unas buenas propiedades electroconductoras para las diferentes superficies, que permiten la difusión rápida de la sonda electroquímica hacia el electrodo. Se puede apreciar un aumento considerable en la corriente anódica cuando el electrodo se modifica mediante las estrategias 1 (ΔI anódico = 0.22 ± 0.05 ma) y 5 (ΔI anódico = 0.13 ± 0.02 ma) frente al electrodo sin nanoestructurar, debido al aumento del área electroquímica por la presencia de MWCNTs. Como se comprobó en las imágenes de SEM, la nanoestructuración mediante la estrategia 2 produce un recubrimiento menor, por lo que el aumento en la corriente anódica para el [Fe(CN) 6 ] 4-/3- es más modesto (ΔI anódico = 0.03 ± 0.01 ma) en este caso. El comportamiento electroquímico de las plataformas obtenidas mediante las tres estrategias se estimó a partir de la separación entre el pico anódico y el catódico. Esta separación entre picos queda recogida en la tabla 1.1, siendo, en todos los casos, los valores presentados la media de tres réplicas. 103

115 I ( A) Resultados y discusión. Capítulo 1 Tabla 1.1. Separación de picos anódico y catódico de K 3 [Fe(CN) 6 ] para AuSPEs sin nanoestructurar o nanoestructurados con MWCNTs según las diferentes estrategias. Estrategia ΔE p (mv) sin MWCNTs 0.27 ± ± ± ± 0.03 La nanoestructuración mediante la estrategia 2 produce una pequeña disminución en la ΔE p y la estrategia 5 no produce variaciones sustanciales al comparar con el electrodo no nanoestructurado (ΔE p = 0.27 ± 0.03 V). Sin embargo, la nanoestructuración mediante la estrategia 1 produce una separación considerablemente menor (ΔE p = 0.12 ± 0.01 V). Teniendo en cuenta el trabajo de Gooding [Gooding, 2005] esta disminución significa que, aunque los nanotubos empleados son demasiado largos para obtener una verticalidad perfecta, la estrategia 1 da lugar a una distribución ligeramente perpendicular a la superficie del electrodo, como ya se observó en las imágenes y perfiles de AFM, en comparación con la estrategia 5, que conduce a una cama de MWCNTs. La estrategia 2 produce una ligera perpendicularidad E (V) Fig Voltamperogramas cíclicos de CSPEs antes ( ) y tras la nanoestructuración según la estrategia 1 ( ) y estrategia 5 ( ) en tampón fosfato 0.1 M ph 7.0 en presencia de K 3 [Fe(CN) 6 ] 5 mm a 100 mv s

116 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio En la figura 1.16 se muestran los voltamperogramas cíclicos de CSPEs nanoestructurados mediante las estrategias 1 y 5. En este caso, se observa también la respuesta típica del par redox [Fe(CN) 6 ] 4-/3-. La separación de picos (ΔE p ) para los CSPEs se recoge en la tabla 1.2. Tabla 1.2. Separación de picos anódico y catódico de K 3 [Fe(CN) 6 ] para CSPEs sin nanoestructurar o nanoestructurados con MWCNTs según las diferentes estrategias. Estrategia ΔE p (mv) sin MWCNTs 0.25 ± ± ± 0.03 Los CSPEs presentan un comportamiento voltamperométrico similar a los AuSPEs. La ΔE p para el electrodo no nanoestructurado es en este caso 0.25 ± 0.01, muy próxima a la que presenta el AuSPE no nanoestructurado. De nuevo, la nanoestructuración mediante la estrategia 5 supone una variación muy pequeña en la separación de picos y la nanoestructuración mediante la estrategia 1 provoca un comportamiento más reversible de la sonda (ΔE p = 0.19 ± 0.01). De esta manera se confirma que la estrategia 1 produce plataformas con un mejor comportamiento electroquímico. 1.3 Modificación con 3,4-DHS de las plataformas basadas en MWCNTs El objetivo principal de la nanoestructuración de los electrodos con MWCNTs es su aplicación en el desarrollo de plataformas electrocatalíticas frente a la oxidación de moléculas de interés. Existen ejemplos en la bibliografía del uso de nanotubos de carbono con este fin en la detección de diferentes moléculas, tales como el uso de matrices de nanotubos de carbono ordenados verticalmente mediante fotolitografía para la detección de glutamato [Gholizadeh, 2012] o la detección de NADH mediante la nanoestructuración de electrodos con SWCNTs o MWCNTs [Musameh, 2002] o con CNTs dispersos en ácido hialurónico [Filip, 2011] o el uso de MWCNT-COOH disuelto en una mezcla de DMF y agua en la modificación de electrodos para la detección de p- acetaminofen, dopamina o peróxido de hidrógeno [Fanjul-Bolado, 2007]. 105

117 Resultados y discusión. Capítulo 1 Además de la mejora que implica el uso de nanotubos de carbono en el desarrollo de plataformas electrocatalíticas, se han descrito también otros ejemplos donde el uso de los nanotubos va acompañado de un mediador redox que mejora el proceso catalítico y lo hace más específico. Algunos de estos ejemplos son el uso de azul de Meldola y glutamato deshidrogenasa en la detección de glutamato [Chakraborty, 2007] o la detección de NADH mediante compósitos de tionina, CNTs y nafion [Huang, 2007], películas de CNTs, nafion y un mediador redox electroquímicamente generado a partir de serotonina, la 5,5 -dihidroxi-4,4 -bitriptamina [Raj, 2006], CNTs y alizarina [Puchakayala, 2012] o compósitos híbridos de CNTs funcionalizados con ácido xanturénico y flavín adenín dinucleótido (FAD) para la detección de NADH y H 2 O 2 [Lin, 2013]. Como ya se ha comentado, el 3,4-DHS presenta en su estructura grupos o-quinona, que han sido descritos como potentes electrocatalizadores, especialmente cuando se encuentran depositados o polimerizados sobre electrodos sólidos. Por ejemplo, películas de 3,4-dihidroxibenzaldehído electrodepositadas sobre electrodos de carbón vítreo presentan actividad electrocatalítica hacia la electrooxidación de NADH [Pariente, 1994; Pariente, 1996]. También se han empleado derivados de o-quinona en la reducción del alto sobrepotencial observado en la electrooxidación de hidrazina [Wang, 1996a; Golabi, 1999b; Golabi, 1999a; Golabi, 2001], entre ellos, el propio 3,4-DHS [Revenga-Parra, 2005]. El 3,4-DHS presenta dos grupos quinona/hidroquinona en su estructura. El proceso redox global de la molécula involucra cuatro electrones y cuatro protones, tal como se muestra en la figura En su conjunto la molécula muestra un gran número de dobles enlaces conjugados, lo que sugiere una gran cantidad de carga deslocalizada a lo largo de la estructura molecular, circunstancia ideal para actuar como mediador de proceso de intercambio de electrones. 106

118 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio OH O OH O N N -4e - -4H + +4e - +4H + N N OH O OH O Fig Esquema del proceso de oxidación/reducción de los grupos quinona/hidroquinona del 3,4-DHS El 3,4-DHS presenta, además, anillos aromáticos en su estructura, que le confieren cierta planaridad y sugiere la posibilidad de que se puedan adsorber sobre los nanotubos mediante interacciones π-π con los anillos de las capas superiores. Teniendo en cuenta estas propiedades, se ha estudiado la modificación de las plataformas modificadas con MWCNTs desarrolladas y caracterizadas anteriormente, con 3,4-DHS con el objetivo de construir plataformas electrocatalíticas frente a la oxidación de NADH e hidrazina. La idea es que los electrones presentes en las formas reducidas de estos analitos puedan ser cedidos a la forma oxidada del mediador y que estos fluyan a través de los MWCNTs hacia la superficie electródica, dando lugar a una corriente electrocatalítica más alta que en ausencia de estos modificadores Modificación de AuSPEs con 3,4-DHS La modificación de las plataformas desarrolladas con 3,4-DHS se llevó a cabo mediante adsorción directa del compuesto sobre AuSPEs nanoestructurados con MWCNTs. El mediador redox se disolvió en metanol, donde presenta una mayor solubilidad que en medio acuoso. Esto permite aumentar la concentración, además de facilitar el proceso de evaporación del disolvente. La respuesta electroquímica de los electrodos nanoestructurados resultantes se estudió mediante voltamperometría cíclica en tampón fosfato 0.1 M (ph 7.0). El 107

119 I (µa) I (µa) Resultados y discusión. Capítulo 1 potencial se barrió entre -0.2 V y +0.4 V a una velocidad de 100 mv s -1. En la figura 1.18 se puede observar el comportamiento voltamperométrico tras la modificación con 3,4-DHS de las plataformas desarrolladas basadas en electrodos serigrafiados de oro sin nanoestructurar ( ) y nanoestructurados con MWCNTs (AuSPE/MWCNTs) según la estrategia 1 ( ), estrategia 2 ( ), estrategia 3 ( ), estrategia 4 ( ) y estrategia 5 ( ). Para mayor claridad, los voltamperogramas correspondientes a las estrategias 3 y 4 se muestran en la figura 1.18B. Como se puede observar, en todos los casos, aparecen dos procesos redox parcialmente superpuestos, que se pueden adscribir a la presencia de los dos grupos quinona/hidroquinona del 3,4-DHS. Este comportamiento sólo se observa en electrodos serigrafiados. En electrodos de carbón vítreo solo se aprecia un proceso redox [Revenga-Parra, 2005]. 3 A 0.6 B E (V) E (V) Fig Voltamperogramas cíclicos de AuSPEs antes ( ) y tras la nanoestructuración según la estrategia 1 ( ), estrategia 2 ( ), estrategia 3 ( ) y estrategia 4 ( ) y estrategia 5 ( ) modificados con 3,4-DHS en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. Los potenciales de pico para cada una de las estrategias se recogen en la tabla

120 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Tabla 1.3. Potenciales de pico para AuSPEs/MWCNTs modificado con 3,4-DHS para las diferentes estrategias de nanoestructuración con MWCNTs. estrategia E pa1 (V) E pa2 (V) E pc1 (V) E pc2 (V) sin MWCNTs En las plataformas desarrolladas mediante las estrategias 1 y 2 el pico anódico se desplaza a potenciales más negativos que en el electrodo no nanoestructurado, al igual que para la estrategia 5, aunque en este caso el desplazamiento es mucho menor. El pico catódico se desplaza en los tres casos hacia potenciales más positivos. Este comportamiento concuerda con lo observado anteriormente con la sonda [Fe(CN) 6 ] 4-/3- en disolución y se puede explicar teniendo en cuenta la presencia de nanotubos y a la disposición alineada verticalmente de estos en las estrategias 1 y 2. La nanoestructuración mediante las estrategias 3 y 4 da lugar a un desplazamiento del par redox hacia potenciales más positivos. En este caso, como se observó en las imágenes de SEM (fig D y E), la cantidad de MWCNTs presente es muy pequeña y el desplazamiento en el potencial se puede atribuir a la capa de 4-ATP. Por otro lado, la presencia de MWCNTs produce un aumento en el área específica de la superficie, que se vería reflejada en un aumento de la corriente de pico. La mayor intensidad se observa para las plataformas derivadas de la estrategia 5. Esto se debe a una mayor densidad de MWCNTs, como se pudo observar en las imágenes de SEM (fig F). En la estrategia 2 y, especialmente, en las estrategias 3 y 4, se observa una disminución de la corriente de pico, que se puede explicar por la presencia de la capa de 4-ATP, que dificulta la adsorción del 3,4-DHS, en el caso de las estrategias 3 y 4, más acusado debido a la escasez de MWCNTs a los que adsorberse. A partir de la carga (Q) obtenida de la integración de la onda anódica de los voltamperogramas de AuSPEs/MWCNTs modificados con 3,4-DHS, se calculó el 109

121 Q ( C) Resultados y discusión. Capítulo 1 recubrimiento superficial de 3,4-DHS usando la ecuación Γ=Q/n F A, donde A es el área electroactiva del electrodo y considerando que están involucrados en el proceso 4 electrones, según se describe en el apartado 4.1 de la sección materiales y métodos. El área electroquímica se calculó, como se describe en el apartado 4.2 de la sección materiales y métodos, utilizando de la ecuación Q=2n F C D 1/2 t 1/2 π -1/2 A [Bard, 2001], donde la carga (Q) se estimó a partir de medidas cronocolumbimétricas en presencia de K 3 [Fe(CN) 6 ]. Como coeficiente de difusión (D) se utilizó el valor de x10-10 cm 2 s -1 [Adams, 1969] Q ( C) t (s) t 1/2 (s 1/2 ) Fig Representación de la carga (Q) frente a t 1/2 o frente t (inserto) para la estimación del área electroquímica para AuSPE en K 3 [Fe(CN) 6 ] 5 mm en tampón fosfato 0.1 M ph 7.0 con KCl 1 M para el electrodo no nanoestructurado. En la tabla 1.4 aparecen recogidos los recubrimientos superficiales, así como las áreas electroactivas, para cada una de las estrategias empleadas. 110

122 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Tabla 1.4. Recubrimiento superficial de 3,4-DHS adsorbido y área electroactiva de AuSPEs sin nanoestructurar o nanoestructurados con MWCNTs según las diferentes estrategias. Estrategia Γ (mol cm -2 ) A (cm 2 ) sin MWCNTs (5.8 ± 0.1) x (6.42 ± 0.09) x (1.18 ± 0.05) x (8.5 ± 0.3) x (7.5 ± 0.2) x (1. 0 ± 0.1) x Como cabría esperar, el mayor recubrimiento se obtiene cuando se emplea la estrategia 5, que produce una gran área específica, mientras que para las estrategias 3 y 4 el recubrimiento obtenido es mucho más bajo debido a la capa de 4-ATP, que dificulta la adsorción del 3,4-DHS, como se comentó anteriormente Modificación de CSPEs con 3,4-DHS En el caso de las plataformas desarrolladas basadas en electrodos serigrafiados de carbono modificadas con nanotubos (CSPEs/MWCNTs), el comportamiento voltamperométrico tras la modificación con 3,4-DHS es similar al observado en el caso de los AuSPEs. En la figura 1.20 se muestran los voltamperogramas de CSPEs sin nanoestructurar ( ) y nanoestructurados con MWCNTs según la estrategia 1 ( ) y estrategia 5 ( ). 111

123 I ( A) Resultados y discusión. Capítulo E (V) Fig Voltamperogramas cíclicos de CSPEs antes ( ) y tras la nanoestructuración según la estrategia 1 ( ) y estrategia 5 ( ) modificados con 3,4-DHS en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. En este caso, también se observan los dos procesos redox superpuestos del 3,4-DHS. Sin embargo, no se observa desplazamiento de potencial (tabla 1.5), debido a la naturaleza carbonácea tanto del nanomaterial como del electrodo. La mayor intensidad se obtiene con la nanoestructuración según la estrategia 5, de nuevo debido a la mayor densidad de MWCNTs. Tabla 1.5. Potenciales de pico para CSPEs/MWCNTs modificado con 3,4-DHS para las diferentes estrategias de nanoestructuración con MWCNTs. estrategia E pa1 (V) E pa2 (V) E pc (V) sin MWCNTs Al igual que para los AuSPEs, se calculó el recubrimiento superficial a partir de la carga obtenida de la integración de la onda anódica de los voltamperogramas de CSPEs/MWCNTs modificados con 3,4-DHS y del área electroactiva estimada por cronocolumbimetría. En la tabla 1.6 aparecen recogidos los recubrimientos superficiales, así como las áreas electroactivas, para cada una de las estrategias empleadas. 112

124 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Tabla 1.6. Recubrimiento superficial de 3,4-DHS adsorbido y área electroactiva de CSPEs sin nanoestructurar o nanoestructurados con MWCNTs según las diferentes estrategias. Estrategia Γ (mol cm -2 ) A (cm 2 ) sin MWCNTs (7.8 ± 0.2) x (9.5 ± 0.1) x (1. 6 ± 0.1) x El mayor recubrimiento se obtiene también para la estrategia 5, debido a la mayor área creada por los MWCNTs. La presencia de MWCNTs en las plataformas desarrolladas mediante la estrategia 1 provoca también un aumento en el área superficial al comparar con el electrodo no nanoestructurado. En vista de los resultados obtenidos, se puede afirmar que no solo la presencia de MWCNTs inmovilizados sobre la superficie del electrodo, sino también su distribución y configuración, influyen de manera significativa en el comportamiento voltamperométrico final de las especies redox tanto en disolución ([Fe(CN) 6 ] 4-/3- ) como confinadas en la superficie (3,4-DHS). 1.4 Propiedades electrocatalíticas de las plataformas SPE/MWCNTs/3,4- DHS Como se ha comentado anteriormente, el propósito fundamental del desarrollo de las plataformas basadas en la nanoestructuración de los electrodos con MWCNTs y con 3,4-DHS es la aplicación de estas plataformas en la construcción de dispositivos sensores frente a la oxidación de analitos de interés. Las moléculas que contienen en su estructura grupos o-quinona, como el 3,4-DHS, presentan una fuerte actividad electrocatalítica frente a la electrooxidación de NADH [Pariente, 1994; Pariente, 1996], de ácido ascórbico [Moreno, 2000] y de hidrazina [Wang, 1996a; Golabi, 1999b; Golabi, 1999a; Golabi, 2001; Revenga-Parra, 2005]. Por este motivo, se han estudiado las propiedades electrocatalíticas de los electrodos nanoestructurados con MWCNTs mediante las diferentes estrategias y, posteriormente, con 3,4-DHS en la electrooxidación de NADH e hidrazina. 113

125 Resultados y discusión. Capítulo Oxidación electrocatalítica de NADH El NADH es la forma reducida del β-nicotinamida Adenina Dinucleótido y se conoce como NAD+ en su forma oxidada. Es parte de un sistema redox que juega un papel importante en la transferencia electrónica en enzimas oxidorreductasas. La estructura de este cofactor enzimático está formada por dos nucleótidos, la adenina y la nicotinamida, unidos por un puente difosfato (figura 1.21). Entre ellos, la nicotinamida es la responsable de las propiedades redox de este compuesto y actúa como mediador en numerosos sistemas biológicos. El par NAD+/NADH está involucrado en más de 300 reacciones enzimáticas catalizadas por deshidrogenasas y la semirreacción de este sistema implica la transferencia de dos electrones y un protón (figura 1.21). NH 2 O N N O - O - NH 2 N N O O P O O P O O O N + OH OH OH OH H O H H O NH e - + H + NH 2 N + N R R Fig Representación esquemática del cofactor NAD + y reacción de reducción del sistema NAD+/ NADH. La cuantificación de este cofactor es importante para estudios de procesos biológicos, así como para el desarrollo de herramientas analíticas utilizadas en control de calidad alimentario, ambiental o en laboratorios clínicos. La oxidación de NADH es un proceso de gran interés en el campo de los biosensores, ya que permite la determinación indirecta de los sustratos de las enzimas deshidrogenasas, a través de la cuantificación del NADH generado en la reacción enzimática. Sin embargo, la 114

126 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio oxidación directa de NADH en la superficie de electrodos clásicos requiere un alto sobrepotencial debido a su alta energía de activación. A ph 7.0 el potencial termodinámico para esta reacción es V frente al electrodo de calomelanos. Sin embargo, en electrodos de carbono, platino y oro la oxidación de NADH tiene lugar a potenciales cercanos a +0.4 V, +0.7 V y +1.0 V (frente al electrodo de calomelanos), respectivamente [Samec, 1983]. En electrodos serigrafiados de oro (AuSPEs) esta oxidación sucede a potenciales por encima de 0.4 V (figura 1.22A ). Además, durante la oxidación de NADH se produce un envenenamiento de la superficie debido a la acumulación de los productos de la oxidación, lo que provoca una disminución de la respuesta electroquímica. Una manera de evitar estos inconvenientes es la modificación de la superficie del electrodo con compuestos que actúen como mediadores redox. De esta manera se mejora la transferencia electrónica y se reduce el sobrepotencial, a la vez que se puede minimizar la adsorción de sustancias sobre la superficie del electrodo. Por este motivo, existe un gran interés en el desarrollo de nuevas modificaciones electródicas con propiedades electrocatalíticas hacia la oxidación de NADH con el objeto de mejorar las propiedades analíticas de los dispositivos sensores. En este sentido, las quinonas son una familia de compuestos que presentan unas propiedades ideales para su aplicación como electrocatalizadores en la oxidación de NADH, especialmente las o-quinonas [Carlson, 1985]. Tse y Kuwana describieron por primera vez la actividad electrocatalítica frente a la oxidación de NADH de un electrodo de grafito pirolítico modificado covalentemente con o-quinonas, concretamente con 3,4-dihidroxibencilamina y dopamina [Tse, 1978]. Desde entonces se han empleado diferentes o-quinonas para conseguir reducir el sobrepotencial al que se produce la oxidación de NADH, como 3,4 y 2,5-dihidroxibenzaldehído [Pariente, 1994; Pariente, 1996], catecol [Maleki, 2012] o 1,4-bis(3,4-dihidroxifenil)- 2,3-dimetilbutano [Ciszewski, 2000]. Por otra parte, los nanotubos de carbono se han utilizado como modificadores de electrodos en el desarrollo de sensores de NADH [Musameh, 2002; Chen, 2004] ya que, además de las propiedades generales de los nanomateriales, presentan propiedades electrocatalíticas frente a la oxidación de este compuesto, a la vez que 115

127 Resultados y discusión. Capítulo 1 inhiben la adsorción de especies sobre la superficie del electrodo. Por tanto, la combinación de las propiedades electrocatalíticas de las o-quinonas junto con las propiedades que aportan los nanotubos de carbono puede generar plataformas electrocatalíticas sensibles y robustas para su aplicación como sensores de NADH. La figura 1.22 muestra los voltamperogramas cíclicos de AuSPEs antes (A) y tras la nanoestructuración según la estrategia 1 (B), estrategia 2 (C), estrategia 3 (D), estrategia 4 (E) y estrategia 5 (F) en presencia de NADH 1 mm. Como se puede apreciar, la presencia de MWCNTs en las plataformas desarrolladas produce una disminución en el potencial de oxidación del NADH ( ) cuando se comparan con los AuSPEs no nanoestructurados. En el caso de las estrategias 3 y 4, al igual que para los electrodos no nanoestructurados, no se observa el pico de oxidación en la ventana de potencial estudiada. 9 A B C I ( A) D E F I ( A) E (V) E (V) E (V) Fig Voltamperogramas cíclicos de AuSPEs antes (A) y tras la nanoestructuración según la estrategia 1 (B), estrategia 2 (C), estrategia 3 (D), estrategia 4 (E) y estrategia 5 (F) sin modificar ( ) y modificados con 3,4-DHS en presencia ( ) y en ausencia ( ) de NADH 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 10 mv s

128 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Cuando además se modifican con 3,4-DHS ( ), aparecen los dos procesos redox característicos adscritos a los grupos quinona/hidroquinona comentados anteriormente. La modificación con 3,4-DHS provoca la oxidación electrocatalítica de NADH ( ) a potenciales más bajos, cuando se compara con las plataformas AuSPEs/MWCNTs sin 3,4-DHS, especialmente, las plataformas derivadas de la estrategia 1. Los potenciales de pico para la oxidación de NADH se recogen en la tabla 1.7. Tabla 1.7. Potenciales de pico de oxidación de NADH para AuSPEs/MWCNTs modificado o no con 3,4-DHS para las diferentes estrategias de nanoestructuración con MWCNTs. - 3,4-DHS estrategia E p (V) E p (V) sin MWCNTs > > > En el caso de las estrategias 3 y 4, la oxidación de NADH se produce a potenciales más altos que en ausencia de MWCNTs, probablemente debido a la presencia de la capa de 4-ATP, a la pequeña cantidad de MWCNTs presentes y al bajo recubrimiento de 3,4-DHS. Por otro lado, las plataformas derivadas de la adsorción directa (estrategia 5) dan lugar a las corrientes catalíticas más altas, como cabría esperar debido al alto recubrimiento obtenido. Sin embargo, en este caso la eficiencia catalítica, definida como el cociente entre la intensidad de corriente en presencia y en ausencia del analito, es menor que para la estrategia 1 (tabla 1.8). 117

129 Resultados y discusión. Capítulo 1 Tabla 1.8. Eficiencia catalítica en la oxidación de NADH para las plataformas AuSPEs/MWCNTs modificadas con 3,4-DHS para las diferentes estrategias de nanoestructuración con MWCNTs. estrategia eficiencia catalítica sin MWCNTs 9.2 ± ± ± ± ± ± 0.4 Existen tres factores importantes a la hora de decidir cuál es la mejor plataforma electrocatalítica: la corriente catalítica, el potencial de pico y la eficiencia catalítica. En este caso, y teniendo en cuenta los tres factores, se puede concluir que la estrategia 1 para la incorporación de los nanotubos, combinada con la modificación con 3,4-DHS es la mejor opción para el desarrollo de plataformas electrocatalíticas para la oxidación de NADH Determinación del coeficiente de difusión y de la constante catalítica para NADH Se han calculado tanto el coeficiente de difusión del NADH como la constante catalítica del proceso (k) mediante cronoamperometría a 0.19 V, siguiendo los procedimientos descritos en el capítulo de materiales y métodos. De las pendientes de las representaciones de I CAT frente a t 1/2 obtenidas durante la oxidación de concentraciones crecientes de NADH sobre las plataformas nanoestructuradas desarrolladas según la estrategia 1 y modificadas con 3,4-DHS, se obtuvo un valor para el coeficiente de difusión (D) de NADH de (1.7 ± 0.6) x10-6 cm 2 s -1. Este valor es cercano al publicado previamente para este cofactor en soluciones tampón fosfato (2.4 ± 0.6) x10-6 cm 2 s -1 ) [Moiroux, 1980] en electrodos sin nanoestructurar. La constante catalítica para la reacción entre el NADH y la plataforma electrocatalítica desarrollada se evaluó usando el procedimiento descrito por Galus [Galus, 1991]. En la figura 1.23 se muestran los valores de I CAT /I D respecto a la raíz cuadrada del tiempo 118

130 pendientes Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio de medida para distintas concentraciones de NADH. La representación de las pendientes de las rectas obtenidas frente a la raíz cuadrada de la concentración (fig inserto) da lugar a una nueva recta de cuya pendiente se obtiene la constante catalítica. En este caso, se obtuvo un valor de (1.1 ± 0.4) x10 3 M -1 s M I CAT /I D c 1/2 (M 1/2 ) 0.2 M t 1/2 (s 1/2 ) Fig Representación de I CAT /I D frente a t 1/2 para NADH sobre AuSPEs/MWCNTs según la estrategia 1 y modificada con 3,4-DHS. Inserto: Representación de las pendientes de las rectas frente a la raíz cuadrada de la concentración. Este valor confirma que las plataformas desarrolladas por nanoestructuración de AuSPEs mediante la estrategia 1 en combinación con 3,4-DHS presentan un alto poder catalítico frente a la oxidación de NADH. Sin embargo, el valor de la constante es inferior a los encontrados en la bibliografía para electrodos nanoestructurados con CNTs. Por ejemplo, el trabajo de Lin y colaboradores [Lin, 2012] en el que se describe la modificación de un electrodo de carbón vítreo con poliluminol y MWCNTs funcionalizados con grupos carboxílicos, con una k de 2.19 x10 4 M 1 s 1, o el de Karimi-Maleh y colaboradores [Karimi-Maleh, 2014], donde se describe la modificación con un complejo de rutenio, óxido de zinc y MWCNTs de un electrodo de pasta de carbono, con una k de 4.1 x10 3 M 1 s 1. No obstante, en ambos casos el potencial aplicado es mucho mayor que en el sensor desarrollado. 119

131 I (µa) I SS (µa) Resultados y discusión. Capítulo Propiedades analíticas del sensor de NADH Las propiedades analíticas como sensor de NADH de la plataforma electrocatalítica desarrollada mediante nanoestructuración de AuSPEs con nanotubos siguiendo la estrategia 1 en combinación con 3,4-DHS se obtuvieron a partir de medidas cronoamperométricas de un solo potencial en disoluciones sin agitar y conteniendo concentraciones crecientes de NADH. Se aplicó un pulso de potencial desde V hasta 0.19 V. El criterio de elección de estos potenciales se basa en la variación desde un potencial donde no exista reacción faradaica a otro en el que la oxidación de NADH se considere completa. Los cronoamperogramas se registraron en disolución no agitada para asegurar control difusional del analito a la superficie del electrodo µm [NADH] (µm) t (s) Fig Cronoamperogramas de la oxidación de NADH en la plataforma AuSPEs/MWCNTs modificada con 3,4-DHS en tampón fosfato 0.1 M ph 7.0. Inserto: Corriente en el estado estacionario (I ss ) a 45 segundos frente a la concentración de NADH. En la figura 1.24 se muestran los cronoamperogramas correspondientes a concentraciones crecientes de NADH en tampón fosfato 0.1 M a ph 7.0. Se puede observar cómo se estabiliza la corriente de estado estacionario (I ss ) a los pocos segundos de aplicar el pulso de potencial. La representación de I ss frente a la concentración de NADH produce una respuesta lineal en el intervalo de concentración 120

132 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio de 5.0 a 350μM. Estos resultados revelan que la nueva plataforma electrocatalítica puede utilizarse como sensor de NADH en estas condiciones. Los parámetros analíticos del método desarrollado se estimaron a partir tramo lineal de la curva de calibrado. Los datos se recogen en la tabla 1.9. La sensibilidad obtenida a partir de la pendiente del tramo lineal fue de (2.5 ± 0.1) x10-3 μa μm -1. Los límites de detección y cuantificación se calcularon como la concentración que da una señal igual a tres o diez veces la desviación estándar de la corriente del blanco, respectivamente. La corriente del blanco se determinó a partir de tres electrodos modificados con MWCNTs y 3,4-DHS en las mismas condiciones de medida en ausencia de analito. Los límites de detección y cuantificación obtenidos fueron 3.4 ± 0.7 μm y 8.1 ± 0.7 μm, respectivamente. La reproducibilidad se ha calculado para 3 electrodos distintos y se ha expresado como porcentaje de desviación estándar relativa (R.S.D.%). Se considera que un método es reproducible cuando este valor es inferior al calculado para el coeficiente de variación de Horwitz (CV H ) para una concentración determinada [Wood, 1999]. El CV H se calcula según la ecuación: CV H = 2 (1 0.5logC) donde C representa la concentración. Para una concentración de 20 μm, el valor calculado de CV H es Este valor es superior al obtenido experimentalmente de 8.8, por lo que se puede asegurar que el sensor desarrollado presenta una buena reproducibilidad. Tabla 1.9. Parámetros analíticos obtenidos para la oxidación electrocatalítica de NADH sobre las plataformas AuSPEs/MWCNTs preparadas mediante la estrategia 1 en combinación con 3,4-DHS. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (μm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) Estabilidad x % 15 min 121

133 Resultados y discusión. Capítulo 1 El sensor de NADH desarrollado presenta unos parámetros analíticos similares o mejores al comparar con otros sensores de NADH basados en electrodos modificados con nanotubos recogidos en la bibliografía en cuanto a sensibilidad ((2.5 ± 0.1) x10-3 μa μm -1 ) y límites de detección (3.4 ± 0.7 μm) y cuantificación (8.1 ± 0.7 μm). En el trabajo de Yuan y colaboradores [Yuan, 2011] se describe un sensor de NADH basado en la modificación de un electrodo de carbón vítreo distribuyendo sobre el electrodo un compósito de MWCNTs y el péptido difenilalanina, con un límite de detección de 10 μm y en el trabajo de Filip y colaboradores [Filip, 2011] se describe otro sensor de NADH basado en la modificación de un electrodo de carbón vítreo con una dispersión de SWCNTs en ácido hialurónico, con un límite de detección de 63 μm. Gasnier y colaboradores [Gasnier, 2012] describen un sensor de NADH basado la modificación de un electrodo de carbón vítreo mediante deposición una dispersión de MWCNTs en una solución de polietilenimina funcionalizada con dopamina, con un límite de detección de 3 μm y un intervalo lineal hasta 100 μm. En todos los casos, la modificación del electrodo con los CNTs se realiza mediante adsorción física. La nanoestructuración covalente mediante electroinjerto de sales de diazonio se espera que produzca plataformas con una gran estabilidad. En el proceso de oxidación del NADH se generan especies resultantes de reacciones de dimerización y desprotonación [Lorenzo, 1998; Blaedel, 1976], que pueden depositarse sobre el electrodo inactivándolo. Uno de los retos cuando se desarrollan sensores electroquímicos, especialmente de NADH, es obtener diseños con estabilidad operacional a largo plazo que hagan posibles determinaciones sucesivas sin pasivación de la superficie. La utilización de nanomateriales en estos diseños favorece su estabilidad al dificultar la adsorción de los productos de la reacción sobre la superficie del electrodo. La estabilidad operacional del sensor desarrollado se evaluó tras 15 minutos de trabajo continuo en presencia de NADH 1.0 mm. Se obtuvo una respuesta del 92%, confirmando que el electrodo sufre un mínimo envenenamiento. Igualmente, se estudió también la estabilidad del sensor desarrollado tras su almacenamiento a temperatura ambiente durante tres semanas. El sensor mantuvo el 100% de su actividad frente a una concentración de NADH 1.0 mm en tampón fosfato 122

134 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio 0.1 M a ph 7.0 durante todo este periodo, gracias a la unión covalente de los MWCNTs a la superficie del electrodo Oxidación electrocatalítica de hidrazina La hidrazina es un compuesto químico formado por nitrógeno e hidrógeno (N 2 H 4 ) con extensas aplicaciones en una gran variedad de áreas como la química industrial, militar, agricultura y farmacológica. Por ejemplo, destaca por ser un importante material anódico utilizado en celdas de combustible o como propulsor de cohetes en la industria aeroespacial [Yamada, 2003]. Además, se emplea en procesos industriales como inhibidor de la corrosión, catalizador o emulsionante [Amlathe, 1988; Vernot, 1985], aunque también como antioxidante, reductor, revelador de fotos o en la producción de insecticidas. En el lado negativo, la hidrazina es un compuesto corrosivo, irritante y tóxico, catalogado como potencial carcinógeno, mutágeno y hepatotóxico, que puede causar daño en hígado y riñones [Becker, 1981]. Por todo ello, es un analito de interés biológico y medioambiental. H H N N H H Fig Estructura de la hidrazina. Debido a la importancia de su determinación, se ha descrito una gran variedad de métodos para ello basados en técnicas como la espectrofotometría [Ganesh, 2012; Safavi, 1995], cromatografía [Smolenkov, 2012; Elias, 2006; Kirchherr, 1993], fluorescencia [Collins, 1994] o culombimetría [Pastor, 1983], entre otros. Estos métodos requieren de tratamientos de la muestra extensos, tediosos y caros, por lo que los sensores electroquímicos se presentan como una alternativa para la determinación de hidrazina debido a su elevada sensibilidad, selectividad y rapidez. Generalmente, la determinación de hidracina mediante técnicas electroquímicas se basa en su oxidación sobre la superficie del electrodo. Teniendo en cuenta que el pk a de la hidrazina es 7.9 [Adams, 1963], a ph menor de 8.0 la forma predominante será 123

135 I (µa) Resultados y discusión. Capítulo 1 la protonada, es decir, N 2 H + 5. En estas condiciones, la oxidación de hidrazina en medio acuoso es un proceso que implica la transferencia de cinco protones y cuatro electrones: N 2 H + 5 N 2 + 5H + + 4e - El potencial termodinámico para la semirreacción de la hidrazina es V frente al electrodo normal de hidrogeno [Bard, 1985]. En electrodos de carbono, la oxidación de hidrazina presenta un gran sobrepotencial; a ph 7 para electrodos de carbón vítreo la oxidación de hidrazina sucede a 0.8 V [Ahmar, 2013]. Cuando se utilizan electrodos serigrafiados de carbono (figura 1.26A ), tiene lugar a potenciales por encima de 0.5 V. Con la finalidad de reducir este sobrepotencial se ha descrito el uso de diferentes mediadores redox, tales como el ácido cafeico [Golabi, 1999a], el ácido clorogénico [Golabi, 1999b], el pirocatecol violeta [Golabi, 2001], el 3,4- dihidroxibelzaldehído [Pamidi, 1996] y también el 3,4-DHS [Revenga-Parra, 2005]. En todos ellos, la actividad redox proviene del grupo funcional quinona/hidroquinona. 40 A B C E (V) E (V) E (V) Fig Voltamperogramas cíclicos de CSPEs antes (A) y tras la nanoestructuración según la estrategia 1 (B) y estrategia 5 (C) sin modificar ( ) y modificados con 3,4- DHS en presencia ( ) y en ausencia ( ) de hidrazina 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. En la figura 1.26 se pueden ver los voltamperogramas cíclicos de CSPEs antes (A) y tras la nanoestructuración según las estrategias 1 (B) y 5 (C) en presencia de hidrazina 1 mm. En ella se puede observar que la oxidación de hidrazina en las plataformas desarrolladas con MWCNTs ( ) tiene lugar a potenciales más bajos (ver 124

136 Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio tabla 1.10) que cuando se utiliza el electrodo no nanoestructurado, donde no se observa el pico de oxidación en la ventana de potencial estudiada. La posterior modificación con 3,4-DHS provoca la aparición de los dos procesos redox característicos ( ), como se ha visto anteriormente. La presencia de hidrazina produce la aparición de una corriente catalítica ( ), como se puede observar por el aumento de la corriente de oxidación y la desaparición del pico de reducción. Tabla Potenciales de pico de oxidación de hidrazina para CSPEs/MWCNTs modificado o no con 3,4-DHS para las diferentes estrategias de nanoestructuración con MWCNTs. - 3,4-DHS eficiencia estrategia E p (V) E p (V) catalítica sin MWCNTs > ± ± ± 1 Al igual que se observó en el caso de las plataformas basadas en AuSPEs para la catálisis de NADH, la nanoestructuración mediante la estrategia 1 en combinación con 3,4-DHS produce la mejor plataforma electrocatalítica para la oxidación de hidrazina cuando se tienen en cuenta la corriente catalítica, el potencial de pico y la eficiencia catalítica Determinación del coeficiente de difusión y de la constante catalítica para hidrazina Siguiendo el procedimiento descrito en el capítulo de materiales y métodos, al igual que en el caso de AuSPEs/MWCNTs con 3,4-DHS para NADH, se calculó el coeficiente de difusión (D) para la plataforma CSPEs/MWCNTs preparada mediante la estrategia 1 (diazotación y electroinjerto de MWCNTs-NH 2 ) en combinación con 3,4-DHS para hidrazina. En este caso, el valor calculado fue de (2.56 ± 0.06) x10 5 cm 2 s 1. Este valor concuerda con el encontrado en la bibliografía para disolución tampón fosfato (2.37 x10 5 cm 2 s 1 ) [Ardakani, 2008]. 125

137 pendientes Resultados y discusión. Capítulo M 0.2 M I CAT /I D c 1/2 (M 1/2 ) t 1/2 (s 1/2 ) Fig Representación de I CAT /I D frente a t 1/2 para hidrazina sobre CSPEs/MWCNTs según la estrategia 1 y modificada con 3,4-DHS. Inserto: Representación de las pendientes de las rectas frente a la raíz cuadrada de la concentración. De igual manera, utilizando el método de Galus, se calculó la constante catalítica para la oxidación de hidrazina sobre la plataforma electrocatalítica desarrollada. En la figura 1.27 se pueden observar las rectas de I CAT /I D frente a t 1/2 para las distintas concentraciones de hidrazina. En el inserto se muestra la recta que se obtiene al representar las pendientes de las rectas anteriores frente a la concentración de hidrazina, de cuya pendiente se obtiene la constante catalítica. En este caso, el valor obtenido es (2.93 ± 0.04) x10 6 M -1 s 1. Este valor tan alto confirma que las plataformas desarrolladas presentan una capacidad catalítica muy elevada, como queda de manifiesto al comparar con otros valores de k reportados en la bibliografía, como los descritos por Adekunle y colaboradores para electrodos de grafito pirolítico activado modificados con CNTs y electrodecorados con películas metálicas y de óxidos de metales: 2.2x10 1 M -1 s -1 para SWCNTs-Ni, 2.0 x10 1 M -1 s -1 para SWCNTs-Fe, 0.24 x10 1 M -1 s -1 para SWCNTs-Co [Adekunle, 2008] y 7.67 x10 2 M -1 s -1 para MWCNTs-Ni [Adekunle, 2010b] o por Ensafi y colaboradores [Ensafi, 2012] para electrodos de pasta de carbono y MWCNTs modificados con p-aminofenol: M -1 s -1. En todos los casos la k calculada es varios órdenes de magnitud menor que la obtenida con la plataforma electrocatalítica desarrollada, lo que pone de manifiesto el gran poder catalítico de esta. 126

138 I (µa) I SS (µa) Plataformas electrocatalíticas basadas en CNTs y en la química de las sales de diazonio Propiedades analíticas del sensor de hidrazina Se estudió también la respuesta del sensor de hidrazina mediante cronoamperometría. Los cronoamperogramas de las plataformas basadas en electrodos serigrafiados de carbono nanoestructurados con nanotubos de carbono y 3,4-DHS a concentraciones crecientes de hidrazina en tampón fosfato 0.1 M a ph 7.0 se muestran en la figura En este caso se aplicó un pulso de potencial desde V hasta 0.26 V. La estabilización de la corriente de estado estacionario (I ss ) fue rápida. Se obtuvo una respuesta lineal (figura 1.28 inserto) en el intervalo de concentraciones entre 0.01 y 2.0 mm, lo que demuestra que las nuevas plataformas sensoras se pueden utilizar como sensores de hidrazina mm [hidrazina] (mm) t (s) Fig Cronoamperogramas de la oxidación de hidrazina en la plataforma CSPEs/MWCNTs modificada con 3,4-DHS en tampón fosfato 0.1 M ph 7.0. Inserto: Corriente en el estado estacionario (I ss ) a 45 segundos frente a la concentración de hidrazina. En la tabla 1.11 se recogen los parámetros analíticos obtenidos. La sensibilidad (1.90 ± 0.01 x10-2 µa µm -1 ) y los límites de detección (6.0 ± 0.6) µm y cuantificación (19.0 ± 0.6) µm son comparables a los de otros sensores de hidrazina basados en plataformas modificadas con CNTs, como el descrito por Coates y colaboradores [Coates, 2013], que consiste en la modificación de un electrodo de carbón vítreo mediante la adsorción de SWCNTs, electroinjerto de la sal de 4- azidobencenodiazonio, que reacciona con etinilpiridina y posteriormente se une 127

139 Resultados y discusión. Capítulo 1 ftalocianina de hierro mediante enlace axial con el grupo piridina, o los descritos por Adekunle y colaboradores, que consisten en un electrodo de grafito pirolítico activado modificado por adsorción con SWCNTs y nanopartículas de azul de Prusia [Adekunle, 2010a] o en un electrodo de grafito pirolítico activado modificado por adsorción con SWCNTs y electrodecorado con metales (Ni, Fe y Co) [Adekunle, 2008], donde los límites de detección se encuentran en un intervalo μm. El sensor propuesto es un método más sencillo y rápido, para el que cabe destacar su amplio intervalo de respuesta. Tabla Parámetros analíticos obtenidos para la oxidación electrocatalítica de hidrazina sobre las plataformas CSPEs/MWCNTs preparadas mediante la estrategia 1 en combinación con 3,4-DHS. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (mm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) Estabilidad x % 15 min La reproducibilidad se calculó de igual manera que en el caso anterior. El R.S.D. obtenido para la concentración de 20 μm es de 4.5 %, inferior al valor calculado de CV H, 10.2 [Wood, 1999]. Esto asegura que el sensor desarrollado a partir de CSPEs nanoestructurados con MWCNTs mediante la estrategia 1 y modificados con 3,4-DHS para la determinación de hidrazina presenta una buena reproducibilidad. Se evaluó también la estabilidad operacional, obteniéndose tan solo una disminución en la respuesta del 1% tras 15 minutos de trabajo continuo en presencia de hidrazina 1.0 mm. Teniendo en cuenta los resultados obtenidos se puede concluir que las plataformas sensoras desarrolladas a partir de electrodos serigrafiados nanoestructurados con MWCNTs-NH 2 mediante diazotación y electroinjerto, en combinación con 3,4-DHS presentan las características adecuadas para su utilización como sensor electroquímico para la determinación de NADH e hidrazina, con buenos límites de detección y amplios intervalos lineales. 128

140 Capítulo 2

141

142 Reducción y modificación química de grafeno en un solo paso 2. Reducción y modificación química de grafeno en un solo paso para el desarrollo de plataformas (bio)electrocatalíticas El objetivo de este capítulo es la modificación química de un nanomaterial para la nanoestructuración de electrodos y su uso como plataformas electrocatalíticas para el desarrollo de sensores. En este caso, al igual que en el capítulo anterior, se va a utilizar un nanomaterial perteneciente a la familia del carbono: el grafeno. El grafeno es un material que despierta mucho interés debido a sus propiedades mecánicas, eléctricas, térmicas y ópticas. El método de síntesis más habitual del grafeno se basa en la reducción de óxido de grafeno, cuya obtención es sencilla a partir de la oxidación de grafito. El óxido de grafeno presenta una baja conductividad eléctrica debido a que el sistema π-conjugado se encuentra alterado, como consecuencia del proceso de oxidación. Esta conductividad se puede recuperar mediante la restauración de la red π, por lo que la reducción del GO es una reacción de una gran importancia. Un aspecto interesante sobre el grafeno es la posibilidad de modular sus propiedades mediante modificación con moléculas activas en algún modo. La modificación covalente puede provocar cambios en la estructura electrónica del grafeno y reducir la conductividad eléctrica, mientras que la modificación no covalente minimiza el daño en la red sp 2, por lo que altera menos sus propiedades. En este capítulo se describe la reducción de óxido de grafeno (GO) utilizando como reductor el 3,4-DHS. Este ligando, no solo es capaz de reducir el óxido de grafeno, sino que se adsorbe sobre la superficie del grafeno reducido, de manera que este queda modificado. El material híbrido formado presenta propiedades electrocatalíticas frente a la oxidación de hidrazina al ser depositado sobre electrodos serigrafiados de carbono. Además, es capaz de actuar como mediador redox inmovilizado en la catálisis enzimática de lactato producida por la enzima lactato oxidasa. 131

143 Absorbancia Resultados y discusión. Capítulo Interacción de óxido de grafeno con 3,4-DHS Como se ha comentado con anterioridad, el 3,4-DHS presenta anillos aromáticos en su estructura, es decir, grupos planares, que podrían interaccionar con los anillos aromáticos del óxido de grafeno mediante unión no covalente. Por este motivo, se ha estudiado la interacción entre GO y 3,4-DHS mediante espectrofotometría de absorción UV-visible y de emisión. En primer lugar, se registró el espectro de absorción del GO. La suspensión de GO se sonicó antes de su utilización para asegurar que el material de partida se encuentra exfoliado en forma de óxido de grafeno nm nm (nm) Fig Espectro de absorción de una suspensión de GO 20 µg ml -1 en tampón fosfato 0.1 M ph 7.0. Como se puede observar en la figura 2.1, el GO presenta una banda de absorción a 235 nm, que está asociada a la transición π-π* del doble enlace C=C y un hombro a 299 nm, asociado a la transición n-π* del C=O [Luo, 2009], características del óxido de grafeno. De igual manera, se registró el espectro de absorción del 3,4-DHS. El 3,4-DHS es una molécula fluorescente [Revenga-Parra, 2007], por lo que se registraron también los espectros de emisión. A ph 7.0, las moléculas de 3,4-DHS se encuentran en su forma neutra, es decir las iminas están desprotonadas (pk anh =4.88) y los hidroxilos, protonados (pk aoh =8.99) [Abad, 2011]. 132

144 Absorbancia Intensidad Reducción y modificación química de grafeno en un solo paso 290 nm A nm B nm (nm) (nm) Fig Espectros de absorción (A) y emisión (λ ex = 290 nm) (B) de una disolución que contiene 3,4-DHS 100 µm en tampón fosfato 0.1 M ph 7.0. El espectro de absorción (figura 2.2A) presenta una banda de absorción intensa a 290 nm, asociada a las transiciones π-π* de los grupos fenólicos y otra banda a 325 nm, asociada a las transiciones n-π* de los grupos imina y anillos aromáticos [Abad, 2011]. En el espectro de emisión (figura 2.2B) se puede observar una banda centrada a 370 nm, cuando se utiliza una longitud de onda de excitación de 290 nm. Se estudió espectrofotométricamente la interacción entre GO y 3,4-DHS. Se registraron los espectros de disoluciones conteniendo GO y concentraciones crecientes de 3,4-DHS, tanto de absorción como de emisión, tras 24 horas para permitir la interacción entre el nanomaterial y el ligando. 133

145 Absorbancia Intensidad Resultados y discusión. Capítulo 2 3 A 300 B M M 100 M (nm) (nm) Fig Espectros de absorción (A) y emisión (λ ex = 290 nm) (B) de disoluciones que contienen GO 20 µg ml -1 y 3,4-DHS entre 5 y 200 µm en tampón fosfato 0.1 M ph 7.0. En el espectro de absorción (figura 2.3A) se puede observar un aumento en la banda de absorción del 3,4-DHS a 290 nm a medida que aumenta la concentración de este. No se observa desplazamiento en la banda de absorción del 3,4-DHS por la presencia del GO, lo que parece indicar que la interacción entre el nanomaterial y las moléculas de 3,4-DHS es pequeña. Esto se puede explicar por la presencia de grupos funcionales en la superficie de GO, lo que hace que no abunden las regiones formadas por carbonos sp 2 sobre las que se pueda adsorber el 3,4-DHS. En el espectro de emisión (figura 2.3B) se observa la banda característica a 370 nm del 3,4-DHS, que aumenta en intensidad con la concentración de 3,4-DHS hasta alcanzar un valor máximo a 100 μm y luego disminuye por la gran cantidad de moléculas presentes, que chocan entre sí, de manera que pierden energía, en lo que se conoce como amortiguación dinámica. 2.2 Reducción de óxido de grafeno con 3,4-DHS La baja conductividad del GO supone un inconveniente para su utilización en la nanoestructuración de electrodos, ya que puede impedir la transferencia electrónica. Sin embargo, la reparación del sistema π-conjugado mediante la reducción del GO, da lugar a la recuperación de su conductividad. De esta manera, el material resultante 134

146 Reducción y modificación química de grafeno en un solo paso presenta unas propiedades adecuadas para su uso en el desarrollo de plataformas electrocatalíticas. Además, la reducción de GO para formar grafeno reducido (rgo) genera láminas con una proporción significativamente menor de grupos oxigenados, lo que provoca un aumento, tanto en el tamaño como en la cantidad, de regiones sp 2 disponibles para la funcionalización no covalente. En la literatura, se encuentran ejemplos de reducción de GO mediante el uso de agentes reductores como la hidrazina [Stankovich, 2007] o el borohidruro sódico (NaBH 4 ) [Shin, 2009], entre otros. Es interesante destacar que también ha sido descrita la reducción de GO utilizando hidroquinona como reductor. En el trabajo de Wang [Wang, 2008a], la reducción se lleva a cabo mediante calentamiento a reflujo de una mezcla acuosa de GO e hidroquinona. La presencia de grupos hidroquinona en la estructura del 3,4-DHS (figura 2.4) lo convierte en un potencial agente reductor para el GO. Además, como se ha visto en el capítulo anterior para los nanotubos de carbono, el 3,4-DHS puede adsorberse sobre la superficie formada por carbonos sp 2. Por este motivo se evaluó la posibilidad de utilizar el 3,4-DHS como reductor, a la vez que modificador, en la reducción de GO, según el esquema de la figura 2.4. OH O OH OH O O OH OH OH O OH O OH O + Fig Esquema de la reducción de GO con 3,4-DHS Efecto de la concentración de 3,4-DHS en la reducción de óxido de grafeno Con la idea de potenciar el efecto reductor de 3,4-DHS, de acuerdo con los datos de la bibliografía [Wang, 2008a], las disoluciones del apartado anterior (2.1), que contenían GO y 3,4-DHS en diferentes concentraciones, se calentaron a 100 ºC 135

147 Absorbancia Intensidad Resultados y discusión. Capítulo 2 durante 1 hora. Pasado ese tiempo, se registraron los espectros de absorción y emisión que se muestran en la figura A B M 200 M 100 M (nm) (nm) Fig Espectros de absorción (A) y emisión (λ ex = 290 nm) (B) de disoluciones que contienen GO 20 µg ml -1 y 3,4-DHS entre 0 y 0.2 mm en tampón fosfato 0.1 M ph 7.0 después de calentar durante 1 hora. En el espectro de absorción (figura 2.5A), se observa la aparición de una nueva banda alrededor de 530 nm, que se puede asociar a las transiciones n-π* del puente fenileno formado a través de los nitrógenos sobre la superficie del grafeno [Abad, 2011]. En el espectro de emisión (figura 2.5B), aparecen la banda a 370 nm, que ya aparecía en el espectro de la disolución antes de calentar, y una nueva banda a 417 nm. La banda a 370 nm se asocia a la forma reducida de 3,4-DHS, mientras que la banda a 417 nm se puede asociar a la forma oxidada de 3,4-DHS, formada al reducir al GO. Se observa, además, que la banda de 3,4-DHS a 370 nm disminuye, provocado por la presencia de grafeno reducido, que, al ser más insoluble, produce una amortiguación dinámica. La mayor intensidad de fluorescencia se observa para la concentración de 3,4-DHS de 0.1 mm, por lo que se eligió esta concentración para continuar los estudios. 136

148 Absorbancia Intensidad A I Reducción y modificación química de grafeno en un solo paso Efecto del tiempo de reacción en la reducción de óxido de grafeno con 3,4-DHS Ya que el calentamiento durante 1 hora produce cambios en el óxido de grafeno, para determinar el tiempo óptimo de reacción, se estudió la influencia del tiempo de calentamiento, entre 1 y 9 horas. 3 9 horas B t (h) t (h) 0 0 A (nm) 9 horas (nm) Fig (A) Espectros de absorción e inserto: absorción a 530 nm y (B) espectros de emisión (λ ex = 290 nm) e inserto: emisión a 370 nm ( ) y a 417 nm ( ) de disoluciones que contienen GO 20 µg ml -1 y 3,4-DHS 0.1 mm en tampón fosfato 0.1 M ph 7.0 antes y después de calentar durante entre 1 y 9 horas. En los espectros de absorción (figura 2.6A) se puede apreciar que la banda a 530 nm, asociada al puente fenileno, va desapareciendo con el tiempo, probablemente, debido a que, según se va reduciendo el grafeno, las regiones sp 2 disponibles aumentan en tamaño y número y se favorece la interacción entre el grafeno reducido y el 3,4-DHS mediante apilamiento π-π. En la representación de la absorbancia a 530 nm frente al tiempo de reacción (figura 2.6A inserto) se alcanza un máximo a las 4 horas de reacción, que se mantiene para tiempos superiores. En los espectros de emisión (figura 2.6B) se observa que tanto la banda asociada a la forma reducida (370 nm) como a la oxidada (417 nm) del 3,4-DHS disminuyen con el tiempo, alcanzando un mínimo a las 5 horas y manteniéndose para tiempos de reacción más largos. Teniendo en cuenta estos resultados, se eligió 5 horas como el tiempo óptimo de reacción. 137

149 Absorbancia Intensidad Resultados y discusión. Capítulo Caracterización del material sintetizado Tras el tratamiento térmico, la suspensión de grafeno y 3,4-DHS pasa de un color marrón a un precipitado negro. Esto se debe probablemente a un aumento en la hidrofobicidad del material causado por una disminución en los grupos funcionales polares de la superficie de las láminas de grafeno [Stankovich, 2007]. Este cambio en las propiedades del material, apreciables a simple vista, hace pensar que la reducción de GO a grafeno reducido con 3,4-DHS para formar el material híbrido (rgo-dhs) ha sido exitosa Caracterización de rgo-dhs mediante espectrofotometría de absorción y emisión El material sintetizado se caracterizó mediante espectrofotometría de absorción UVvisible y de emisión de fluorescencia en disolución. En la figura 2.7 se muestran los espectros del rgo-dhs ( ) y de la mezcla de GO y 3,4-DHS antes de ser sometida al tratamiento térmico de reducción ( ). 3 A 300 B (nm) (nm) Fig Espectros de absorción (A) y emisión (λ ex = 290 nm) (B) de rgo-dhs ( ) y de una disolución que contiene GO 20 µg ml -1 y 3,4-DHS 0.1 mm ( ) en tampón fosfato 0.1 M ph 7.0. En el espectro de absorción (figura 2.7A) no se observa desplazamiento en la banda a 290 nm en el rgo-dhs con respecto a la mezcla de los precursores, aunque se 138

150 Absorbancia Intensidad Reducción y modificación química de grafeno en un solo paso vuelve más ancha, debido a la interacción π-π entre el grafeno y el 3,4-DHS. Además, se aprecia una mayor dispersión de la luz, seguramente debido a la menor solubilidad del rgo-dhs con respecto al GO. En el espectro de emisión (figura 2.7B) se observa una amortiguación de la fluorescencia del rgo-dhs, que puede ser debida a la presencia de la forma más insoluble del grafeno, que provoca una amortiguación dinámica. Además, se hace predominante la segunda banda a 417 nm, que está relacionada con la forma oxidada del 3,4-DHS, lo que concuerda con lo esperado tras la reducción del GO. El objetivo perseguido al utilizar 3,4-DHS como agente reductor del GO es que el ligando se quede adsorbido sobre la superficie del grafeno reducido obteniendo grafeno modificado químicamente, que combina las propiedades de ambas sustancias. Para comprobar que esta interacción es lo suficientemente fuerte y la modificación es estable, una vez reducido, el rgo-dhs se centrifugó y se lavó con agua para eliminar todo el 3,4-DHS libre. Tras su resuspensión en tampón fosfato 0.1 M a ph 7.0 se registraron los espectros de absorción y emisión. 1.5 A 1.5 B (nm) (nm) Fig Espectros de absorción (A) y emisión (λ ex = 290 nm) (B) de rgo-dhs tras centrifugación y resuspensión en tampón fosfato 0.1 M ph 7.0. Como se puede observar, el espectro de absorción (figura 2.8A) presenta una forma similar al obtenido antes de la centrifugación. En él aparece la banda a 290 nm del 3,4-DHS. 139

151 Resultados y discusión. Capítulo 2 En el espectro de emisión (figura 2.8B) aparecen las dos bandas a 370 y 417 nm de 3,4-DHS, sin embargo, la intensidad de emisión disminuye con respecto a la que presentaba antes de centrifugar, debido a la menor cantidad de 3,4-DHS presente. De los resultados obtenidos se puede deducir que la composición cualitativa es la misma que antes de la centrifugación, ya que aparecen las bandas asociadas al 3,4-DHS. Se puede concluir que el 3,4-DHS se encuentra fuertemente adsorbido sobre la superficie del grafeno, de manera que este queda químicamente modificado, formando el material híbrido rgo-dhs Caracterización de rgo-dhs mediante espectroscopía Raman Una de las técnicas más empleadas en la caracterización del grafeno es la espectroscopía Raman. Esta técnica se basa en la dispersión inelástica de una luz monocromática y ofrece información sobre los modos vibracionales y rotacionales del material. El espectro Raman de los materiales carbonáceos presenta dos bandas relativamente intensas asociadas a los carbonos sp 2, las bandas D y G. La banda G aparece siempre en la región cm -1 y está asociada con la vibración de los carbonos sp 2, tanto de los anillos como de las cadenas. La banda D suele aparecer alrededor de 1355 cm -1 y se asocia con la vibración fuera del plano de los carbonos sp 2 de los anillos aromáticos. Este modo vibracional está prohibido en el grafito y se vuelve activo en presencia de defectos estructurales [Ferrari, 2000]. Otras bandas menos intensas presentes en los espectros Raman de los materiales de carbono amorfo son la banda D, también asociada a la presencia de defectos, y los sobretonos 2D, D+G y 2G. La relación de las intensidades de las bandas D y G (I D /I G ) se usa como un indicador del grado de desorden. En un primer momento, Tuinstra y Koenig establecieron que, en el caso del grafito nanocristalino, la relación I D /I G era inversamente proporcional al tamaño de las regiones sp 2 [Tuinstra, 1970]. Años más tarde, Ferrari y Robertson [Ferrari, 2000] expusieron que, cuando la densidad de defectos es alta y, por tanto, el tamaño de los dominios cristalinos es pequeño, la fuerza del modo D es proporcional a la probabilidad de encontrar un anillo hexagonal en esa región, es decir, al tamaño 140

152 Reducción y modificación química de grafeno en un solo paso de la región. Así, para carbonos amorfos, como es el caso tanto del GO como del grafeno reducido (rgo), un aumento en la relación I D /I G indica un mayor grado de orden. En la figura 2.9 se muestran los espectros Raman de rgo-dhs y GO. Como se puede ver, el rgo-dhs (2.9A) presenta dos bandas intensas centradas en 1348 y 1591 cm -1, las bandas D y G, así como otras menos intensas, la banda D, centrada en 1603 cm -1 y los sobretonos 2D, D+G y 2G en la región cm -1. Para el ajuste de las curvas se han usado funciones Lorentzianas, excepto en el caso de la banda G, para la que se ha usado una función Breit Wignar Fano (BWF) [Ferrari, 2000]. La posición de las bandas se muestra en la tabla 2.1. Al comparar con el GO (figura 2.9B) se puede apreciar la diferencia en la relación I D /I G. En el caso del GO, esta relación es de 0.90 ± 0.03, mientras que para rgo-dhs es de 1.07 ± 0.02, siendo ambos valores la media de diez espectros. Estos valores indican que el rgo- DHS es un material más ordenado, con regiones sp 2 de mayor tamaño que el GO. Intensidad Raman (a. u.) D G A G D D' D' D+D' 2D D+D' 2D 2D' 2D' Número N de de onda (cm -1-1 ) ) Número N de de onda (cm -1-1 )) B Fig Espectro Raman de (A) rgo-dhs y (B) GO. La línea roja corresponde al ajuste y las líneas grises a los diferentes componentes del ajuste. Láser de excitación de 488 nm. A modo de comparación se registraron los espectros Raman de grafeno reducido con otros reductores empleados comúnmente, como son el NaBH 4 [Shin, 2009] y la hidrazina [Stankovich, 2007], según el procedimiento recogido en la sección de materiales y métodos. 141

153 Resultados y discusión. Capítulo 2 Intensidad Raman (a. u.) D G A D G D' D' D+D' 2D D+D' 2D 2D' 2D' Número N de de onda onda (cm (cm -1 ) -1 ) Número N de de onda onda (cm (cm -1 ) -1 ) B Fig Espectro Raman de (A) rgo con NaBH 4 y (B) rgo con hidrazina. La línea roja corresponde al ajuste y las líneas grises a los diferentes componentes del ajuste. Láser de excitación de 488 nm. En ambos espectros (figura 2.10) se observa la misma tendencia que en la reducción con 3,4-DHS, un aumento en la relación I D /I G, como se puede comprobar en los valores recogidos en la tabla 2.1. Tabla 2.1. Desplazamiento Raman de las bandas para GO y rgo con 3,4-DHS, NaBH 4 e hidrazina, expresado en cm -1. Los parámetros de medida son: potencia de láser de 70 µw, tiempo de integración de 0.5 s y objetivo 100x. banda GO rgo-dhs rgo NaBH 4 rgo hidrazina D G D D D+D D I D /I G 0.90 ± ± ± ± 0.01 Estos resultados permiten afirmar que el GO ha sido efectivamente reducido y que el 3,4-DHS es un buen reductor en la síntesis de rgo, comparable con otros reductores conocidos, como la hidrazina o el NaBH

154 Reducción y modificación química de grafeno en un solo paso 2.4 Desarrollo de electrodos modificados con rgo-dhs La modificación química del grafeno con 3,4-DHS permite obtener un material híbrido que combine las propiedades de ambos componentes, que pueden tener diferentes aplicaciones. Por otro lado, en la bibliografía se encuentran diferentes ejemplos del uso de grafeno reducido en el desarrollo de sensores electroquímicos, dado que este presenta una mejor conducción. Por ejemplo, el trabajo de Takahashi [Takahashi, 2013] en el que se describe la detección de hidrazina y peróxido de hidrógeno utilizando un electrodo de carbón vítreo sobre el que se ha electrorreducido GO, o el de Liu [Liu, 2016], que describe un sensor de hidrazina utilizando un electrodo de carbón vítreo modificado con nanopartículas de oro y platino sobre grafeno. En otros trabajos, además del grafeno reducido, se utilizan moléculas electroactivas para dotar al electrodo de propiedades específicas, por ejemplo, electrocatálisis. Algunos ejemplos son los trabajos de Ameen [Ameen, 2012], donde se utiliza un electrodo de óxido de estaño fluorado modificado con grafeno reducido y polianilina para determinación de hidrazina o el de Wang [Wang, 2010], en el que se describe el uso de un electrodo de carbón vítreo modificado con grafeno reducido y poliestireno sulfonato para la determinación de hidrazina. El 3,4-DHS presenta propiedades electrocatalíticas frente a la oxidación de NADH e hidrazina debido a la presencia de grupos o-quinona en su estructura [Revenga- Parra, 2005; Bravo, 2015]. El material híbrido sintetizado, rgo-dhs, se espera que presente las propiedades de ambos precursores. Por este motivo, se estudió el comportamiento electroquímico de electrodos serigrafiados de carbono nanoestructurados con rgo-dhs (CSPEs/rGO-DHS) y su potencial aplicación como plataformas electrocatalíticas hacia moléculas de interés Caracterización de los electrodos nanoestructurados con rgo-dhs mediante voltamperometría cíclica En la figura 2.11 se muestra el voltamperograma de un CSPE nanoestructurado con rgo-dhs ( ). Se puede observar en él un par redox con picos anódico y catódico centrados en y V, respectivamente. Este par se adscribe al sistema 143

155 Resultados y discusión. Capítulo 2 quinona/hidroquinona presente en el 3,4-DHS, confirmando de nuevo que el 3,4-DHS se encuentra sobre la superficie del grafeno. La separación de picos (ΔE p ) de V está lejos de ser cero, que es el valor predicho por la teoría que explica el comportamiento de especies adsorbidas en la superficie del electrodo [Bard, 2001], lo que sugiere que existen limitaciones en la transferencia de carga. 2 I ( A) E (V) Fig Voltamperogramas cíclicos de CSPEs nanoestructurado con rgo-dhs ( ) y con una mezcla de GO y 3,4-DHS sometida al tratamiento de centrifugación ( ) en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. A modo de comparación, una mezcla de GO y 3,4-DHS no sometida al tratamiento térmico, es decir, que no se ha producido la reducción del GO, se centrifugó al igual que se hizo con el rgo-dhs y se depositó sobre el electrodo. En el voltamperograma correspondiente ( ) no se observa el par redox del 3,4-DHS. Esto es debido a que apenas se produce la adsorción de 3,4-DHS sobre el GO por el reducido tamaño de las regiones formadas por carbonos sp Efecto del ph La respuesta voltamperométrica del rgo-dhs se debe a los grupos quinona/hidroquinona del 3,4-DHS, por lo que se espera que sea dependiente del ph. Por este motivo, se estudió el efecto del ph en la respuesta de los electrodos nanoestructurados con rgo-dhs mediante voltamperometría cíclica. 144

156 E 0 ' (V) Reducción y modificación química de grafeno en un solo paso En los voltamperogramas de la figura 2.12A se puede observar que los potenciales de pico, tanto anódico como catódico, se van desplazando hacia valores más negativos al aumentar el ph de la disolución. 6 A B I ( A) E (V) ph Fig (A) Voltamperogramas cíclicos de CSPEs/rGO-DHS a diferentes a diferentes valores de ph: 3.0 ( ), 5.0 ( ), 7.0 ( ), 9.0 ( ) y 11.2 ( ) a 10 mv s -1. (B) Potenciales formales en función del ph. El potencial formal del par redox (E 0 ) se desplaza hacia potenciales más negativos de forma lineal en función del ph, con una pendiente de mv/unidad de ph (figura 2.12B). Este valor es el esperado para sistemas que intercambian el mismo número de protones que de electrones. Teniendo en cuenta esto, el proceso redox para cada grupo quinona/hidroquinona se puede representar como: QH 2 red Q ox + 2e - + 2H + El proceso global para 4 electrones y 4 protones está representado en la figura 1.17 del capítulo Efecto de la velocidad de barrido En la figura 2.13 se muestran los voltamperogramas cíclicos de CSPEs nanoestructurados con rgo-dhs en tampón fosfato 0.1 M ph 7.0 a velocidades de barrido inferiores a 0.6 V s -1. En el inserto de esa figura se puede observar que, para estas velocidades, las corrientes de pico anódica y catódica siguen una relación lineal 145

157 I ( A) I (µa) Resultados y discusión. Capítulo 2 con la velocidad de barrido, lo que es característico de materiales redox confinados en la superficie del electrodo. Además, el potencial formal del sistema se mantiene más o menos constante para velocidades de barrido bajas, lo que indica una cinética rápida de transferencia de carga. La separación entre los potenciales de pico de 0.1 V sugiere un comportamiento electroquímico cuasi-reversible. 20 A 0.6 V s V s B v (Vs -1 ) E (V) Fig (A) Voltamperogramas cíclicos de CSPE/rGO-DHS a ph 7.0 a diferentes velocidades de barrido. (B) Variación de la intensidad de corriente anódica ( ) y catódica ( ) con la velocidad de barrido. Se empleó el método de Laviron [Laviron, 1979] para determinar la constante de velocidad de transferencia de carga (k s ) y el coeficiente de transferencia (α) a partir de la variación de los potenciales de pico anódico y catódico obtenidos para diferentes velocidades de barrido. En la figura 2.14A se representan estos potenciales frente al logaritmo de la velocidad de barrido. Para velocidades superiores a 0.8 V s -1 los valores de los potenciales de pico siguen una relación lineal con el logaritmo de la velocidad de barrido, como puede observarse en la figura 2.14B. A partir de estos resultados se han obtenido los valores de 8.92 s -1 para k s y de 0.51 para α. Se ha considerado que cada molécula intercambia cuatro electrones, dos por cada grupo funcional quinona/hidroquinona. 146

158 E p (V) E (V) Reducción y modificación química de grafeno en un solo paso 0.5 A B log v log v Fig (A) Variación del potencial de pico anódico ( ) y catódico ( ) con el logaritmo de la velocidad de barrido para CSPE/rGO-DHS modificados con 3,4-DHS a ph 7.0 a diferentes velocidades de barrido. (B) Ampliación de la gráfica anterior para velocidades de barrido superiores a 0.8 V s -1. La k s obtenida es mucho menor que la observada para el 3,4-DHS adsorbido sobre electrodos de carbón vítreo, 270 s -1 [Revenga-Parra, 2005]. Esto puede deberse a que el 3,4-DHS no se encuentra directamente adsorbido sobre la superficie del electrodo, sino sobre el grafeno, que, a su vez, está adsorbido sobre la superficie del electrodo, lo que puede ralentizar la transferencia de carga. El valor de α cercano a 0.5 es el esperado para una reacción reversible, donde los procesos de oxidación y reducción son muy similares energéticamente [Bard, 2001] Caracterización de los electrodos modificados con grafeno mediante espectroscopía de impedancia electroquímica (EIS) La espectroscopía de impedancia electroquímica (EIS) es un método eficaz para la caracterización de electrodos modificados, mediante la cual se puede estudiar la conductividad de un electrodo modificado a partir de la medida de la corriente obtenida como respuesta cuando se aplican pequeñas perturbaciones del potencial a una cierta frecuencia impuesta. La impedancia es una resistencia y se define como el cociente entre el potencial aplicado y la intensidad medida [Macdonald, 2005]. 147

159 Resultados y discusión. Capítulo 2 Z(ω) = E(t) I(t) = E m sin(ωt) I m sin(ωt + φ) donde Z (ω) es la impedancia electroquímica del sistema, ω es la frecuencia y Φ es el desfase entre la corriente medida y el potencial aplicado. Habitualmente, la impedancia se expresa como un número complejo, la parte real se representa como Z y la parte imaginaria, como Z. Z(ω) = Z (ω) + jz"(ω) El diagrama de Nyquist es la representación gráfica más común de los datos de espectroscopía de impedancia. En él se representa la impedancia imaginaria (Z ) frente a la impedancia real (Z ). Es un hecho conocido que el grafeno reducido es mejor conductor de la corriente eléctrica que el óxido de grafeno [Stankovich, 2007]. Los resultados obtenidos en experimentos de espectroscopía de impedancia electroquímica con electrodos modificados con GO y con grafeno reducido ponen de manifiesto que existe una diferencia en la respuesta de ambos materiales [Casero, 2012; Stergiou, 2010]. Concretamente, se observa una diferencia en la resistencia a la transferencia de carga, es decir, en la conductividad de los electrodos modificados. Esto hace posible distinguir entre ambos tipos de grafeno. Por este motivo, se utilizó la técnica de espectroscopía de impedancia electroquímica para estudiar el comportamiento de electrodos modificados con rgo-dhs y, a modo de comparación, con GO, en una disolución 10 mm de K 3 [Fe(CN) 6 ] y K 4 [Fe(CN) 6 ] en KCl 0.1 M. La figura 2.15 muestra los diagramas de Nyquist para los CSPE nanoestructurados con rgo-dhs ( ) o con GO ( ). Se pueden apreciar dos intervalos de frecuencia, que corresponden a un control cinético y a un control difusional. A altas frecuencias se observan los semicírculos que corresponden al proceso de resistencia a la transferencia de carga a través de la interfase entre el electrolito y el nanomaterial (R CT ), cuyo valor se puede obtener a partir de la diferencia entre los dos puntos de corte de la curva con el eje. De la intersección de la curva con el eje a altas frecuencias se puede obtener el valor de la resistencia de la disolución (R s ). La doble capa eléctrica formada en la interfase entre el electrodo y la disolución se comporta como un condensador (C) y el valor de su capacitancia se puede calcular a partir de 148

160 Reducción y modificación química de grafeno en un solo paso la frecuencia en el máximo de la curva. La parte lineal observada a frecuencias bajas se relaciona con un proceso difusional. Un sistema electroquímico real se puede considerar como una combinación de procesos y cada uno de ellos se puede representar como un componente electrónico en un circuito equivalente. Los datos experimentales se ajustaron a los circuitos equivalentes mostrados en la figura 2.15, que incluyen, además de R s y R TC, un elemento de impedancia de Warburg (W), que representa la difusión de la sonda redox hacia el electrodo, y un elemento de fase constante (CPE), que simula el comportamiento no ideal de un condensador y combina la capacitancia consecuencia de la modificación de la superficie y de la doble capa. De esta manera, se tiene en cuenta la falta de homogeneidad en la superficie. En el ajuste de este elemento se obtiene un coeficiente de idealidad (n), cuyo valor indica la proximidad del sistema real a uno ideal, la superficie es más homogénea cuanto más cercano a la unidad sea el valor de n. 500 R S CPE 1 CPE 2 Z'' ( ) 250 R CT W CPE 1 R S CPE 2 R CT W Z' ( ) Fig Diagramas de Nyquist de CSPE nanoestructurado con rgo-dhs ( ) y con GO ( ) en KCl 0.1 M conteniendo K 3 [Fe(CN) 6 ] 10 mm y K 4 [Fe(CN) 6 ] 10 mm y circuitos equivalentes. La línea sólida corresponde al ajuste de los datos experimentales. En el caso de los electrodos modificados con rgo-dhs, R CT y CPE 1 corresponden a la interfase entre la disolución y el electrodo nanoestructurado con grafeno reducido y W corresponde a la difusión de la sonda a través del grafeno reducido modificado con el 3,4-DHS. Además, en el ajuste es necesaria la introducción de un segundo 149

161 Resultados y discusión. Capítulo 2 elemento de fase constante, CPE 2, que indica la presencia de una segunda capa, en este caso, el 3,4-DHS que modifica al rgo [Metikoš-Huković, 2003]. En el caso del electrodo modificado con GO, el circuito equivalente (figura 2.15 ) representa una superficie de grafeno parcialmente cubierta por grupos oxigenados. En este caso, R CT y CPE 1 corresponden a la superficie del grafeno libre de esos grupos oxigenados y CPE 2 y W corresponden a las zonas de la superficie donde se encuentran los ácidos carboxílicos, alcoholes, carbonilos [Casero, 2012]. Tanto los datos experimentales obtenidos gráficamente a partir de los diagramas de Nyquist como los obtenidos a partir del ajuste para rgo-dhs y GO se recogen en la tabla 2.2. Se puede observar que el valor de la resistencia a la transferencia de carga es mucho menor en el caso del rgo-dhs, lo que demuestra, como se esperaba, que el rgo-dhs es una material más conductor que el GO. El valor de CPE 1 es del mismo orden de magnitud tanto para el rgo-dhs como para el GO y el coeficiente de idealidad es también similar y cercano a uno, como cabría esperar, ya que se relaciona en ambos casos con la superficie homogénea del grafeno libre de grupos oxigenados. Sin embargo, en el caso de CPE 2, el valor para GO es más elevado, con un coeficiente de idealidad muy alejado de la unidad, lo que se corresponde con una superficie muy heterogénea. Tabla 2.2. Resultados experimentales y de los ajustes de los experimentos de EIS. rgo-dhs GO resultados experimentales R s (Ω) R CT (Ω) C (F) 9.7 x x10-6 resultados de los ajustes R s (Ω) R CT (Ω) CPE 1 (S sn) 0.53 x x10-5 n W (Ω) 0.27 x x10-2 CPE 2 (S sn) 0.72 x x10-2 n

162 Reducción y modificación química de grafeno en un solo paso La resistencia de Warburg es similar en ambos casos debido a la presencia de los grupos oxigenados, que, en el caso del GO pertenecen al propio grafeno y, en el caso del rgo-dhs pertenecen al 3,4-DHS. De estos resultados se puede concluir que existen diferencias electroquímicas entre el electrodo nanoestructurado con GO o con rgo-dhs, en concreto, el electrodo modificado con rgo-dhs presenta una menor resistencia a la transferencia de carga y es, por tanto, más conductor. 2.5 Aplicaciones analíticas de los electrodos modificados desarrollados Oxidación electrocatalítica de hidrazina En el capítulo 1 ya se ha comentado la importancia de la molécula de hidrazina como analito, así como de la relevancia del desarrollo de electrodos modificados que reduzcan el potencial al que se lleva a cabo su determinación. Existen varios ejemplos del uso de grafeno reducido [Takahashi, 2013; Liu, 2016; Ameen, 2012; Wang, 2010], y también de 3,4-DHS [Revenga-Parra, 2005; Bravo, 2015] para lograr la oxidación de hidrazina, con reducción del potencial de hasta 500 mv. Teniendo en cuenta que el nuevo material sintetizado, rgo-dhs, está formado por ambos componentes, se estudiaron las propiedades electrocatalíticas de rgo-dhs frente a la oxidación de hidrazina. En la figura 2.16 se muestran los voltamperogramas cíclicos de los electrodos modificados en ausencia y en presencia de hidrazina 1.0 mm. En ausencia de hidrazina se observan el par redox característico del 3,4-DHS. En presencia de hidrazina, la corriente de pico anódica a 0.22 V se incrementa drásticamente, mientras que la catódica disminuye, lo que indica que se trata de un proceso de oxidación catalítico. 151

163 I (µa) I ( A) Resultados y discusión. Capítulo E (V) Fig Voltamperogramas cíclicos de CSPE/rGO-DHS en ausencia ( ) y en presencia ( ) de hidrazina 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. Tanto el aumento de intensidad de corriente como la disminución del potencial de oxidación son considerables si se comparan con los datos obtenidos al realizar la oxidación de hidrazina en un electrodo sin modificar. Como se observa en la figura 2.17A, esta se produce a un potencial superior a 0.5 V. Lo mismo sucede cuando el electrodo se modifica con GO (figura 2.17B), donde no se observa ningún pico de oxidación en la ventana de potencial estudiada. En el caso del CSPE modificado directamente con 3,4-DHS se observa un pico de oxidación catalítico a 0.26 V, pero con mucha menor intensidad de corriente. 30 A B C E (V) E (V) E (V) Fig Voltamperogramas cíclicos de CSPE no modificado (A), CSPE modificado con GO (B) y con 3,4-DHS (C) en ausencia ( ) y en presencia ( ) de hidrazina 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 10 mv s

164 Reducción y modificación química de grafeno en un solo paso La presencia del nanomaterial disminuye el potencial de oxidación de la hidrazina, además de aumentar la corriente catalítica. Esto resulta más evidente al comparar la eficiencia catalítica, mucho mayor en el caso del CSPE nanoestructurado con rgo-dhs (tabla 2.3) que cuando este se modifica directamente con 3,4-DHS. Este efecto se debe en parte al aumento del área específica que causa la nanoestructuración y a la mejora en la transferencia de carga por parte del grafeno reducido. Tabla 2.3. Potenciales de pico de oxidación de hidrazina y eficiencia catalítica para CSPEs modificados en presencia de hidrazina 1 mm en tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. E pa (V) eficiencia catalítica no modificado > GO > 0.5-3,4-DHS rgo-dhs Estos resultados confirman que los CSPEs nanoestructurados con rgo-dhs son buenas plataformas electrocatalíticas para la oxidación de hidrazina. Con el fin de utilizar estas plataformas nanoestructuradas como sensores de hidrazina, se estudió el efecto del ph y de la velocidad de barrido en el proceso electrocatalítico Efecto del ph en la oxidación electrocatalítica de hidrazina En las reacciones de oxidación, tanto de hidrazina como de 3,4-DHS, hay protones implicados. Por este motivo, es importante estudiar la influencia del ph del medio en la respuesta electrocatalítica. En la figura 2.18A se muestran los voltamperogramas de CSPEs nanoestructurados con rgo-dhs en presencia de hidrazina 1.0 mm a diferentes valores de ph entre 3.0 y Se puede observar cómo a medida que aumenta el ph el potencial de pico catalítico se desplaza hacia valores más negativos, debido a la implicación de los protones en la reacción. Este desplazamiento es lineal con respecto al ph 153

165 I ( A) Ep (V) Resultados y discusión. Capítulo 2 (figura 2.18B), con una pendiente de 69 mv, cercana al valor que corresponde a un proceso en el que se intercambia el mismo número de protones que de electrones A B E (V) ph Fig (A) Voltamperogramas cíclicos de CSPEs/rGO-DHS en presencia de hidrazina 1.0 mm a diferentes valores de ph: 3.0 ( ), 5.0 ( ), 7.0 ( ), 9.0 ( ) y 11.2 ( ) a 10 mv s -1. (B) Potenciales de pico en función del ph. La mayor corriente catalítica (figura 2.18A) se obtiene para los valores de ph de 7.0 y 5.0. Por tanto, se eligió el ph 7.0 como ph de trabajo para los siguientes estudios Efecto de la velocidad de barrido en la oxidación catalítica de hidrazina Con el objeto de elucidar el mecanismo por el que sucede la electrooxidación de hidrazina sobre los CSPE nanoestructurados con rgo-dhs, se estudió la influencia de la velocidad de barrido en este proceso. En la figura 2.19A se muestran los voltamperogramas cíclicos obtenidos en tampón fosfato 0.1 M ph 7.0 en presencia de hidrazina 1.0 mm a diferentes velocidades de barrido. Se puede observar un desplazamiento en el potencial de pico anódico hacia valores más positivos al aumentar la velocidad de barrido, lo que indica una limitación cinética en la oxidación de hidrazina sobre el electrodo nanoestructurado. 154

166 I ( A) Reducción y modificación química de grafeno en un solo paso A 0.2 Vs Vs I ( A) I CAT /v 1/2 E (V) v 1/2 (mv 1/2 s -1/2 ) B C v (mvs -1 ) Fig (A) Voltamperogramas cíclicos de la oxidación de hidrazina 1.0 mm en tampón fosfato 0.1 M ph 7.0 sobre CSPE/rGO-DHS a diferentes velocidades de barrido. (B) Representación de la corriente catalítica en función de la raíz cuadrada de la velocidad de barrido. (C) Representación de la corriente catalítica normalizada con la raíz cuadrada de la velocidad en función de la velocidad de barrido. La corriente de pico anódico sigue una relación lineal con la raíz cuadrada de la velocidad de barrido (figura 2.19B), lo que indica que el proceso catalítico está controlado por la difusión de la hidrazina hacia la superficie del electrodo. La representación de la corriente de pico normalizada con la raíz cuadrada de la velocidad de barrido frente a la velocidad de barrido (figura 2.19C) presenta la forma característica de un mecanismo EC catalítico [Nicholson, 1964]. De acuerdo con esto, se puede describir el proceso de oxidación de hidrazina sobre los CSPEs nanoestructurados con rgo-dhs según el siguiente mecanismo: Hidroquinona-rGO k s - 4e - - 4H + Quinona-rGO k cat N 2 + 5H + + 4e - N 2 H 5 Fig Mecanismo de la oxidación electrocatalítica de hidrazina sobre CSPE/rGO-DHS. 155

167 Resultados y discusión. Capítulo 2 Al potencial inicial de -0.2 V, el 3,4-DHS adsorbido sobre el rgo se encuentra reducido, de manera que los grupos funcionales presentes son hidroquinonas. Al aumentar el potencial, estas hidroquinonas se oxidan sobre la superficie del electrodo, formando quinonas, en un proceso rápido y gobernado por la constante de transferencia de carga entre el rgo-dhs y el electrodo (k s ), calculada en el apartado La presencia de hidrazina provoca la reducción de las quinonas en un proceso gobernado por la constante catalítica (k cat ), de manera que el potencial aplicado vuelve a oxidar las hidroquinonas formadas, comenzando un nuevo ciclo catalítico. De esta manera, se explica el gran incremento en la corriente anódica y la disminución de la corriente catódica, ya que la oxidación de la hidrazina provoca la reducción del 3,4-DHS Determinación de la constante catalítica para hidrazina La constante catalítica para la oxidación de hidrazina sobre los CSPE nanoestructurados con rgo-dhs (k cat ) se estimó mediante cronoamperometría siguiendo el método de Galus [Galus, 1991], según se describe en la sección de materiales y métodos. La representación de los valores de I CAT /I D respecto a la raíz cuadrada del tiempo de medida para distintas concentraciones de hidrazina se muestra en la figura Cuando se representan los valores de las pendientes de estas rectas frente a la raíz cuadrada de la concentración (fig inserto) se obtiene una nueva recta, a partir de cuya pendiente se calcula la constante catalítica. El valor obtenido para este sistema fue de (2.2 ± 0.3) x10 6 M -1 s

168 pendientes Reducción y modificación química de grafeno en un solo paso 40 I CAT /I D c 1/2 600 M 5 M t 1/2 (s 1/2 ) Fig Representación de I CAT /I D frente a t 1/2 para hidrazina. Inserto: Representación de las pendientes de las rectas frente a la raíz cuadrada de la concentración. Este valor es similar al obtenido en el capítulo anterior para las plataformas desarrolladas por nanoestructuración de CSPEs mediante diazotación y electroinjerto de nanotubos de carbono aminados en combinación con 3,4-DHS (2.93 x10 6 M -1 s -1 ). El elevado valor de la constante asegura que los CSPE nanoestructurados con rgo-dhs exhiben un poder catalítico muy alto e indica que los CSPE nanoestructurados con rgo-dhs pueden ser empleados como sensores de hidrazina Propiedades analíticas del sensor de hidrazina Las propiedades como sensor de hidrazina de los CSPE nanoestructurados con rgo-dhs se determinaron mediante cronoamperometría. Se aplicó un pulso de potencial desde V hasta V. En los cronoamperogramas de la figura 2.22, correspondientes a concentraciones crecientes de hidrazina en disolución no agitada para asegurar control difusional, se puede observar que la estabilización de la corriente en estado estacionario (I ss ) es rápida. La respuesta es lineal (figura 2.22 inserto) para concentraciones de hasta 1.5 mm, demostrándose así la capacidad de los electrodos nanoestructurados de actuar como sensores de hidrazina. 157

169 I ( A) Resultados y discusión. Capítulo Iss ( A) M [hidrazina] ( M) t (s) Fig Cronoamperogramas de la oxidación de hidrazina sobre CSPE/rGO-DHS en tampón fosfato 0.1 M ph 7.0. Inserto: Corriente en el estado estacionario (I ss ) a 39 segundos frente a la concentración de hidrazina. La tabla 2.4 recoge los parámetros analíticos del sensor estimados a partir del tramo lineal de la curva de calibrado. De la pendiente del tramo lineal (y= 2.07x + 1.9; R 2 =0.992) se obtuvo una sensibilidad de (2.07 ± 0.06) x10-2 μa μm -1. Los límites de detección y cuantificación, calculados como la concentración que da una señal 3 y 10 veces superior a la desviación estándar de la corriente del blanco, respectivamente, fueron de 0.20 μm y 0.65 μm. La corriente del blanco se estimó para tres electrodos nanoestructurados sumergidos en tampón fosfato 0.1 M ph 7.0. Al comparar con otros sensores de hidrazina descritos en la bibliografía basados en el uso de grafeno reducido, el sensor desarrollado presenta unos parámetros analíticos similares o mejores. Por ejemplo, el trabajo de Aamen [Ameen, 2012] obtiene un límite de detección de mm y el de Wang [Wang, 2010], de 1 µm. En el sensor de hidrazina descrito en el capítulo anterior se obtiene un límite de detección de 6 µm, con una sensibilidad de (1.90 ± 0.01) x10-2 µa µm -1. El sensor desarrollado por nanoestructuración de CSPE con rgo-dhs presenta menor límite de detección y mayor sensibilidad. 158

170 Reducción y modificación química de grafeno en un solo paso Tabla 2.4. Parámetros analíticos obtenidos para la oxidación electrocatalítica de hidrazina sobre CSPE nanoestructurado con rgo-dhs. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (mm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) Estabilidad < x mes Se calculó también el R.S.D. de la respuesta de tres sensores nanoestructurados distintos. Se obtuvo un valor del 4.0 % para una concentración de 5 µm. Este valor es inferior al coeficiente de variación de Horwitz (CV H ) calculado para esa concentración, 12.6 [Wood, 1999], por lo que se puede afirmar que la reproducibilidad del método desarrollado es buena. Se evaluó la estabilidad del sensor desarrollado midiendo la respuesta a 1.0 mm de hidrazina tras un mes de almacenamiento a temperatura ambiente. Esta respuesta se mantuvo constante en todo el periodo. Los resultados obtenidos permiten concluir que los CSPE nanoestructurados con rgo-dhs reúnen las características necesarias para ser utilizados como sensores de hidrazina Desarrollo de un biosensor de lactato El lactato es un analito de interés clínico y agroalimentario. Su concentración en productos lácteos, tales como leche, yogur y cremas, así como en carnes crudas, frutas y vegetales es un indicador de la estabilidad, frescura y calidad de los alimentos. En el caso de los vinos, la fermentación maloláctica transforma el ácido málico en ácido láctico, produciendo un mejor sabor [Przybyt, 2014]. Entre los métodos descritos para la determinación de lactato, el uso de biosensores amperométricos basados en reacciones enzimáticas presenta muchas ventajas, como son especificidad, selectividad, utilización de pequeños volúmenes de muestra, portabilidad y reproducibilidad [Parra, 2006a; Gamella, 2010]. De entre las enzimas utilizadas en el desarrollo de estos dispositivos destaca la lactato oxidasa (LOx), que 159

171 Resultados y discusión. Capítulo 2 cataliza la conversión de lactato a piruvato en presencia de oxígeno, según la reacción: L-lactato + O 2 piruvato + H 2 O 2 Como ya se comentó en la introducción, el curso de esta reacción enzimática se puede seguir electroquímicamente tanto por la disminución de la concentración de O 2 en la disolución como por el aumento de la concentración de H 2 O 2. Sin embargo, el alto sobrepotencial requerido para la determinación de ambas sustancias supone un inconveniente. Una forma de reducir el sobrepotencial necesario para llevar a cabo la tanto la reducción de O 2 como la oxidación de H 2 O 2 y evitar así los problemas derivados de la presencia de interferentes es el uso de mediadores redox, que actúan como aceptores artificiales de los electrones implicados en el proceso, en sustitución del aceptor natural, que es el O 2. Las quinonas pueden actuar como mediador en la oxidación de lactato [Haccoun, 2004]. En este caso, la quinona se convierte en el aceptor de electrones y la corriente medida en el electrodo proviene de la oxidación de la hidroquinona, de acuerdo con las reacciones: L-lactato + LOx ox piruvato + LOx red LOx red + quinona LOx ox + hidroquinona hidroquinona 2e - quinona Dicha corriente es proporcional a la concentración de lactato. Debido a la presencia de grupos quinona en el rgo-dhs, se evaluó la posibilidad de desarrollar un biosensor basado en la nanoestructuración de un electrodo serigrafiado de carbono con rgo-dhs y posterior modificación con la enzima LOx. Para ello, sobre el CSPE nanoestructurado con rgo-dhs se depositó 1.0 U de LOx, como se describe en la sección de materiales y métodos. La respuesta ciclovoltamperométrica del biosensor en ausencia y en presencia de lactato 1.0 mm se muestra en la figura

172 Reducción y modificación química de grafeno en un solo paso I ( A) E (V) Fig Voltamperogramas cíclicos de CSPE/rGO-DHS modificados con LOx en ausencia ( ) y en presencia ( ) de lactato 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 5 mv s -1. En ausencia de lactato se puede observar que, incluso modificado con la enzima, aparece el par redox asociado a los grupos quinona/hidroquinona del 3,4-DHS que modifica al grafeno. En presencia de lactato se observa un aumento en la corriente anódica y una disminución en la corriente catódica, lo que se corresponde con un efecto electrocatalítico. Esto confirma que los electrones responsables de la reducción de la enzima se transfieren rápidamente al 3,4-DHS ox (quinona) inmovilizado, de manera que este se reduce y se inicia de nuevo el ciclo catalítico, según el esquema de la figura Lactato Piruvato LOx red LOx ox 3,4-DHS red 3,4-DHS ox e - ELECTRODO rgo Fig Esquema de funcionamiento del biosensor basado en CSPE/rGO-DHS y LOx. La corriente catalítica producida en el electrodo es proporcional a la concentración de lactato presente en la muestra. Con el fin de comprobar que la respuesta catalítica del 161

173 Resultados y discusión. Capítulo 2 biosensor se debe a la actividad de la enzima LOx inmovilizada, se estudió la respuesta de un CSPE nanoestructurado con rgo-dhs sin modificar con la enzima en presencia de lactato 1.0 mm (figura 2.25). 1 I ( A) E (V) Fig Voltamperogramas cíclicos de CSPE/rGO-DHS en ausencia ( ) y en presencia ( ) de lactato 1.0 mm en tampón fosfato 0.1 M ph 7.0 a 5 mv s -1. Como se puede observar, la adición de lactato ( ) no produce variaciones en la respuesta voltamperométrica al compararla con la del CSPE en las mismas condiciones en ausencia de lactato ( ). Para conocer las condiciones óptimas de funcionamiento del biosensor, se estudió el efecto que produce en su respuesta la variación de parámetros tales como la cantidad de enzima inmovilizada o el ph de trabajo Efecto de la cantidad de enzima Se prepararon varios biosensores preparados con diferentes cantidades de enzima inmovilizada, entre 0.3 y 2.0 U. A medida que se incrementan las unidades de enzima sobre el electrodo (figura 2.26), aumenta la respuesta del biosensor hasta 1.0 U. Mayores concentraciones de enzima producen una ligera disminución en la señal, probablemente debido al comienzo de la formación de una barrera que dificulta la transferencia de los electrones hacia la superficie del electrodo. 162

174 I CAT ( A) I CAT ( A) Reducción y modificación química de grafeno en un solo paso LOx (U) Fig Respuesta del biosensor preparado con diferentes cantidades de enzima LOx en tampón fosfato 0.1 M ph 7.0 conteniendo lactato 1.0 mm a 5 mv s -1. Basándose en estos resultados, se eligió 1.0 U de LOx como la cantidad óptima de enzima para la modificación del CSPE nanoestructurado Efecto del ph Debido a que en el proceso catalítico hay protones implicados y que la enzima tiene un ph de funcionamiento óptimo, se estudió la respuesta del biosensor frente a 1.0 mm de lactato en tampón fosfato 0.1 M a diferentes valores de ph: 6.0, 7.0 y ph Fig Efecto del ph en la respuesta del biosensor a lactato 1.0 mm a 5 mv s

175 Iss ( A) Resultados y discusión. Capítulo 2 Como se puede observar en la figura 2.27, la mejor respuesta se obtiene para ph 7.0. Esto concuerda con lo descrito para otros biosensores de lactato basados en el uso de la enzima lactato oxidasa [Loaiza, 2015; Parra, 2006a]. Se eligió ph 7.0 como el óptimo para la determinación de lactato Propiedades analíticas del biosensor de lactato Una vez halladas las condiciones óptimas de funcionamiento del biosensor, se estudió su respuesta frente a concentraciones crecientes de lactato mediante cronoamperometría. Se aplicó un potencial de +0.1 V. La curva de calibrado (figura 2.28) sigue el modelo de Michaelis-Menten, es decir, a partir de una determinada concentración de lactato, se alcanza una intensidad constante, como se espera de una reacción enzimática [lactato] ( M) Fig Curva de calibrado obtenida de las medidas cronoamperométricas para CSPE/rGO-DHS modificado con LOx en presencia de concentraciones crecientes de lactato en tampón fosfato 0.1 M a ph 7.0. Del tramo lineal de la curva de calibrado (hasta 800 µm), se obtuvieron los parámetros analíticos, que se encuentran resumidos en la tabla 2.5. A partir de la pendiente de la recta, se determinó la sensibilidad, que fue de 7.3 ± 0.1 µa mm -1. Los límites de detección y cuantificación se calcularon como las concentraciones para las que se obtendría una señal correspondiente a tres o diez veces la desviación 164

176 Reducción y modificación química de grafeno en un solo paso estándar del blanco. En este caso, los valores obtenidos fueron 2.9 y 9.7 µm, respectivamente. El límite de detección obtenido es inferior al encontrado en la bibliografía para otros biosensores de lactato basados en el uso de lactato oxidasa. Por ejemplo, en el trabajo de Loaiza [Loaiza, 2015] se describe un biosensor basado en la modificación de CSPEs con nanopartículas de platino sobre nanofibras de carbono grafitizado, con un límite de detección de 6.9 µm y en el de Parra [Parra, 2006a], dos biosensores basados en la adsorción y en la inmovilización covalente de LOx sobre electrodos de oro, con límites de detección de 10 y 40 µm, respectivamente. Tabla 2.5. Parámetros analíticos obtenidos para la oxidación electrocatalítica de lactato sobre CSPE nanoestructurado con rgo-dhs y modificado con LOx. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (µm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) Estabilidad < x % tras 15 días La reproducibilidad del biosensor desarrollado se estimó a partir de la respuesta de tres biosensores preparados siguiendo el mismo procedimiento. Se obtuvo un R.S.D. de 8.9 % para una concentración de 20 μm de lactato. Este valor es inferior a 10.2, que es el valor de CV H calculado para esa concentración, asegurando que el biosensor de lactato desarrollado tiene una buena reproducibilidad. Por último, se estudió la estabilidad del biosensor. Para ello se prepararon tres biosensores y durante dos semanas se midió su respuesta frente a lactato 0.5 mm, observándose que durante ese tiempo el biosensor mantiene un 82% de su actividad. Estos resultados permiten concluir que el biosensor de lactato desarrollado presenta las características adecuadas para ser empleado en la determinación cuantitativa de lactato. 165

177 Resultados y discusión. Capítulo Estudio de interferentes Uno de los aspectos más importantes a tener en cuenta para cualquier aplicación analítica de biosensores es el estudio del efecto de sustancias potencialmente interferentes presentes en las muestras reales. Por tanto, para probar la utilidad del biosensor desarrollado en la determinación de lactato en diferentes muestras reales, tales como vino blanco, se llevó a cabo un estudio del efecto de la presencia de las sustancias potencialmente interferentes más habituales presentes en esas muestras. Con este propósito, se obtuvo la respuesta del biosensor en las condiciones experimentales óptimas en ausencia y en presencia de diferentes concentraciones de ácido tartárico, ácido cítrico, ácido ascórbico, ácido acético, glucosa, fructosa, etanol y metanol. En la tabla 2.6 se muestra la respuesta relativa, definida como el cociente entre la respuesta a lactato 0.5 mm en presencia y en ausencia del potencial interferente, cuando este se encuentra en la misma concentración que el analito (1:1) o en concentración diez veces menor (1:1.01). Tabla 2.6. Respuesta relativa del biosensor a lactato 0.5 mm en presencia de compuestos potencialmente interferentes. Compuesto Intensidad relativa 1:1 1:0.1 Ácido tartárico Ácido cítrico Ácido acético Ácido ascórbico Glucosa Fructosa Metanol Etanol De acuerdo con los resultados recogidos en la tabla 2.6, la presencia de los potenciales interferentes no afecta significativamente a la respuesta, incluso cuando se encuentran en la misma concentración que el analito, excepto en el caso del ácido ascórbico, donde se observó un aumento de la señal de alrededor de un 76%. Sin 166

178 Reducción y modificación química de grafeno en un solo paso embargo, a menores concentraciones, la presencia de este compuesto no mostró ningún efecto. Teniendo en cuenta estos resultados, se puede afirmar que el biosensor desarrollado puede ser utilizado para determinar lactato directamente en muestras reales en presencia de una variedad de compuestos, sin requerir de tediosos pasos de separación previa del analito Determinación directa de lactato en un vino Dada la selectividad del dispositivo se ensayó en la determinación de lactato directamente, sin procesos de separación previa, en vino blanco. Para que las condiciones de medida, es decir, el medio de trabajo y la concentración de la muestra, sean adecuadas, el vino se diluyó en tampón fosfato 0.1 M ph 7.0 (25 µl en 10 ml). Además, para minimizar los efectos de matriz, se empleó el método de adición estándar en la determinación. La concentración determinada en el vino, a partir de los valores obtenidos utilizando tres biosensores diferentes, fue de 1.57 ± 0.05 g L -1. Para asegurar la validez de este resultado, se determinó la concentración de lactato en el vino utilizando un kit enzimático comercial. Este kit se basa en la determinación espectrofotométrica del NADH producido en la reacción enzimática de la L-lactato deshidrogenasa (L-LDH), según se muestra en las reacciones siguientes. L-lactato + NAD + L-LDH Piruvato + NADH + H + (1) Piruvato + D-glutamato D-DGP D-alanina + 2-oxoglutarato (2) Como el equilibrio (1) está muy favorecido en el sentido de L-lactato y NAD +, es necesario acoplar otra reacción (2), catalizada por la enzima glutamato-piruvato transaminasa (D-GPT), que elimina el piruvato del medio, desplazando el equilibrio (1) hacia la producción de NADH. La concentración de lactato obtenida en el vino utilizando este kit comercial fue de 1.73 ± 0.02 g L -1. El resultado obtenido con el biosensor desarrollado es cercano 167

179 Resultados y discusión. Capítulo 2 (90.1%) al valor obtenido empleando el kit comercial, por lo que se concluye que el biosensor desarrollado por nanoestructuración de CSPE con rgo-dhs y modificación con LOx es un método rápido y económico para la determinación de lactato, con el que se obtienen buenos resultados. Tabla 2.7. Determinación de lactato en vino blanco con el biosensor desarrollado y con un kit enzimático comercial. Contenido de lactato (g/l) Contenido de lactato (g/l) Muestra (biosensor LOx) (kit comercial) Vino blanco 1.57 ± ±

180 Capítulo 3

181

182 Síntesis de nanopartículas de oro con 3,4-DHS 3. Síntesis de nanopartículas de oro con 3,4-DHS Continuando con la línea de trabajo comenzada en el capítulo anterior de síntesis de nanomateriales modificados para su aplicación en plataformas electrocatalíticas, en este capítulo se plantea la síntesis en un solo paso de nanopartículas de oro modificadas con 3,4-DHS. Típicamente, la síntesis de nanopartículas de oro (AuNPs) se lleva a cabo mediante la reducción de una sal de oro en presencia de un agente reductor. Debido a la tendencia de estas nanopartículas a agregarse, es necesaria la presencia de un agente estabilizante para mantenerlas en suspensión. En ocasiones, las características necesarias para actuar como agente reductor y estabilizante pueden reunirse en una sola molécula. Este es el caso de la síntesis de Frens [Frens, 1973], donde el citrato reduce la sal de oro y a la vez estabiliza las nanopartículas formadas. En el trabajo descrito en este capítulo se ha pretendido ir un paso más allá y utilizar el 3,4-DHS como agente reductor y estabilizante en la síntesis de nanopartículas de oro modificadas con 3,4-DHS, produciendo nanoestructuras con un alto poder electrocatalítico, al ser depositadas sobre electrodos serigrafiados de carbono, frente a la oxidación de hidrazina y la oxidación y reducción de peróxido de hidrógeno. Además, la detección del peróxido generado enzimáticamente sirve como base para el desarrollo de un biosensor para la determinación de lactato. 3.1 Síntesis de nanopartículas de oro utilizando 3,4-DHS como reductor En el capítulo anterior se demostró que el 3,4-DHS puede actuar como reductor en la reducción de óxido de grafeno a grafeno reducido. Este ligando, como ya se ha comentado, contiene grupos hidroquinona en su estructura. En la bibliografía se encuentran trabajos en los que se describe la preparación de nanopartículas de oro mediante reducción con hidroquinona [Sirajuddin, 2010]. Por lo tanto, se estudió la utilización de 3,4-DHS en la síntesis de nanopartículas de oro, como reductor de 171

183 Absorbancia Intensidad Resultados y discusión. Capítulo 3 HAuCl 4. La viabilidad de esta síntesis se evaluó en primer lugar mezclando directamente concentraciones equimolares de disoluciones de HAuCl 4 y 3,4-DHS. Se observó que la disolución inicial de color amarillo pálido fue cambiando a una dispersión coloidal de color rojo, indicando la formación de las AuNPs. A diferencia del grafeno, en este caso no fue necesaria una alta temperatura para llevar a cabo la reacción, ya que el AuCl - 4 tiene tendencia a reducirse, debido a su alto potencial de reducción, V [Vanýsek, 2009]. En la figura 3.1 se muestran los espectros de absorción y emisión de la dispersión de HAuCl 4 y 3,4-DHS en el momento de la mezcla y tras 96 horas de reacción. En el espectro de absorción UV-visible (figura 3.1A) se puede observar que, tras la reacción, aparece la banda de plasmón superficial característica de las AuNPs a 536 nm ( ), que no está presente al inicio de la reacción ( ) nm A nm 370 nm B (nm) (nm) Fig Espectros de (A) absorción y (B) emisión (λ ex = 310 nm) de soluciones que contienen concentraciones equimolares (0.2 M) de HAuCl 4 y 3,4-DHS en agua en el inicio de la reacción ( ) y tras 96 horas ( ). Dado que el 3,4-DHS es una molécula fluorescente [Revenga-Parra, 2007] se registraron también los espectros de emisión (figura 3.1B), con una longitud de onda de excitación de 310 nm. Se puede observar que el 3,4-DHS presenta inicialmente una banda de emisión a 370nm ( ). Tras la reacción con el HAuCl 4 ( ), la intensidad de fluorescencia de esta banda disminuye y aparece una nueva banda a una longitud 172

184 Síntesis de nanopartículas de oro con 3,4-DHS de onda mayor, 417nm. Esta nueva banda se asocia al grupo quinona presente en el 3,4-DHS en su forma oxidada, resultado de la reducción del tetracloroaurato para dar lugar a las AuNPs. La reacción global de reducción de AuCl 4 - siguiente: por reacción con el 3,4-DHS es la AuCl Au H Cl - Una vez confirmada la posibilidad de utilizar el 3,4-DHS como reductor para la síntesis de AuNPs, el siguiente paso fue establecer las condiciones óptimas de formación de las nanopartículas, para lo que se estudiaron distintos parámetros, como la relación molar entre HAuCl 4 y 3,4-DHS, el ph o la temperatura de reacción Efecto de la relación molar de HAuCl 4 y 3,4-DHS Las concentraciones, tanto de la sal de oro como del agente reductor, juegan un papel importante en la formación de los núcleos a partir de los cuales se forman las partículas y en el tamaño de las partículas resultantes [Turkevich, 1951; Frens, 1973]. Por este motivo se estudió la influencia de la relación de concentraciones entre el HAuCl 4 y el 3,4-DHS en la síntesis propuesta. Para este estudio, la concentración de HAuCl 4 se mantuvo constante en 0.2 M y se fue variando la concentración de 3,4-DHS para obtener relaciones molares AuCl - 4 /DHS desde 1:5 hasta 5:1. Tras 24 horas de reacción, se registraron los espectros (figura 3.2) de absorción (A) y de emisión (B). Cuando únicamente está presente el 3,4-DHS ( ) aparece la banda de absorción (A) a 310 nm, asociada a las transiciones π-π* de los grupos fenólicos y la banda de emisión (B) a 370 nm, con una intensidad muy alta. Se puede observar que para una relación 1:5 ( ) no se observa la banda de plasmón superficial (A), sin embargo la banda de fluorescencia característica del 3,4-DHS a 370 nm disminuye significativamente al compararla con la solución que solo contiene 3,4-DHS ( ). Este hecho puede significar, bien la formación de pequeñas partículas de oro con un 173

185 Absorbancia Intensidad Resultados y discusión. Capítulo 3 tamaño inferior a 2 nm, por lo que no se apreciaría la banda del plasmón, o bien la formación de un complejo entre el Au (III) y el ligando, que estabilizaría la forma oxidada del oro, de manera que el potencial redox del 3,4-DHS no sería suficiente para reducirla. 2.0 A B (nm) (nm) Fig Espectros de (A) absorción y (B) emisión de soluciones que contienen HAuCl M y 3,4-DHS en agua en diferentes proporciones molares: únicamente 3,4-DHS 0.1 M ( ), 1:5 ( ), 1:2 ( ), 2:1 ( ) y 5:1 ( ) tras 24 horas de reacción. Inserto: ampliación de los espectros de emisión. A medida que se va disminuyendo la concentración de 3,4-DHS (relaciones 1:2, 2:1 y 5:1), la banda del plasmón asociada a las AuNPs comienza a aparecer en el espectro de absorción (figura 3.2A). La relación 2:1 ( ) produce una banda de plasmón estrecha y bien definida a 534 nm, lo que sugiere la formación de nanopartículas monodispersas. Para las relaciones 1:2 ( ) y 5:1 ( ), se observan bandas más anchas y desplazadas a mayores longitudes de onda, indicando que las nanopartículas formadas son de mayor tamaño y polidispersas. En los espectros de emisión (figura 3.2B) se observa que, con la formación de las nanopartículas, la intensidad de fluorescencia a 370 nm disminuye y aparece una nueva banda de emisión a 417 nm, atribuida a la forma oxidada del 3,4-DHS (3,4-DHS ox ) producida en el transcurso de la reacción. La amortiguación de la fluorescencia del 3,4-DHS se debe a la presencia de las nanopartículas, que pueden actuar como eficientes amortiguadores del estado excitado [Ipe, 2002]. 174

186 Absorbancia Intensidad Síntesis de nanopartículas de oro con 3,4-DHS Se estudió también la relación molar estequiométrica, 4:3. La banda de plasmón superficial es similar a la obtenida para la relación 2:1 (figura 3.3A), sin embargo, la intensidad de fluorescencia de la banda a 417 nm es menor (figura 3.3B). 2 A B (nm) (nm) Fig Espectros de (A) absorción y (B) emisión de una solución que contiene HAuCl M y 3,4-DHS 0.15 M en agua (proporción molar 4:3) tras 24 horas de reacción. Teniendo en cuenta que con la relación 2:1 se obtienen nanopartículas monodispersas de pequeño tamaño, se eligió como relación óptima para la síntesis de las nanopartículas de oro. Esta relación se alcanza utilizando concentraciones de 0.2 M y 0.1 M para HAuCl 4 y 3,4-DHS, respectivamente Efecto del ph en la síntesis de nanopartículas de oro Estudios previos de interacción de AuNPs con 3,4-DHS muestran que el ph al que sucede esta interacción es un factor importante a tener en cuenta [Abad, 2011]. Por este motivo, se estudió la influencia del ph de la solución de partida en la síntesis para valores de ph entre 5.0 y 9.0. El ph se ajustó con HCl o con NaOH, para evitar la interferencia de las sales presentes en las disoluciones reguladoras de ph en el proceso. 175

187 Absorbancia Intensidad Resultados y discusión. Capítulo A 40 B (nm) (nm) Fig Espectros de (A) absorción y (B) emisión de una solución que contiene HAuCl M y 3,4-DHS 0.1 M en agua a ph 5.0 ( ), ph 7.0 ( ) y ph 9.0 ( ) tras 24 horas de reacción. Al observar los espectros de absorción (figura 3.4A) se puede concluir que no existen diferencias significativas al variar el ph de partida. En todos valores de ph estudiados se observa un máximo a 534 nm, con la única diferencia de una absorbancia ligeramente mayor para ph 5.0 ( ). De manera similar, los espectros de emisión (figura 3.4B) no muestran cambios significativos al variar el ph. En todos los casos se observa la disminución de la intensidad de la banda a 370 nm y la aparición de la nueva banda a 417 nm. Basado en la ausencia de variaciones con el ph, tanto en los espectros de absorción como en los de emisión, se puede concluir que en el intervalo de ph estudiado, este factor es irrelevante para la formación de las nanopartículas de oro Influencia de la temperatura Otro de los factores que puede influir en el proceso de formación de las nanopartículas, en concreto en la morfología y tamaño, es la temperatura [Turkevich, 1985], por lo que se estudió la influencia de esta con la intención de obtener un tamaño menor de partícula al disminuir la temperatura. 176

188 Absorbancia Síntesis de nanopartículas de oro con 3,4-DHS (nm) Fig Espectros de absorción de una solución que contiene HAuCl M y 3,4-DHS 0.1 M en agua a ph 20 ºC ( ) y a 4 ºC ( ) tras 24 horas de reacción. Como se puede apreciar en la figura 3.5, el espectro de absorción de las nanopartículas de oro sintetizadas a 4 ºC es muy similar al obtenido cuando la síntesis se llevó a cabo a temperatura ambiente, indicando que la temperatura no tiene efecto aparente Estudio cinético de la formación de las nanopartículas de oro Con objeto de entender la cinética del proceso de la síntesis de nanopartículas, se estudió la evolución de los espectros de absorción y emisión en función del tiempo. Para ello, se registraron los espectros inmediatamente tras la mezcla de los reactivos y durante 24 horas. Los espectros de absorción de la figura 3.6 muestran que la banda de plasmón superficial centrada a 534 nm es claramente visible tras 10 minutos de reacción y aumenta en intensidad con el tiempo hasta su estabilización a las 6 horas. Además, la banda del 3,4-DHS centrada a 290 nm, atribuida a las transiciones n-π*, se desplaza hacia el rojo 10 nm tras la reacción. Este desplazamiento se puede adscribir a la interacción del O del fenolato con el núcleo metálico [Lezna, 1991]. El ligando se encuentra quimisorbido al oro presumiblemente a través de los fenolatos formados por ruptura del enlace OH, con una orientación perpendicular a la superficie de la 177

189 Absorbancia Resultados y discusión. Capítulo 3 nanopartícula, lo que promueve las interacciones π entre los orbitales fenólicos adyacentes a la nanopartícula. Además, se pueden formar simultáneamente agregados J entre las moléculas de 3,4-DHS y 3,4-DHS ox sobre las nanopartículas, dando lugar al desplazamiento al rojo de la banda de absorción (banda J) con respecto a la del monómero [Abad, 2011]. En los agregados, las moléculas se encuentran unidas unas a otras por uniones cabeza-cola, a través de enlaces de hidrógeno, fuerzas atractivas de van der Waals e interacciones π- π. Li y colaboradores describen de forma similar la interacción entre dos moléculas vecinas a través de la unión del grupo azometino en una molécula y el anillo fenólico en la otra [Li, 2004] h 6h 10min 0 t= (nm) Fig Espectros de absorción de una solución que contiene HAuCl M y 3,4-DHS 0.1 M en agua durante 24 horas de reacción. En la figura 3.7A se muestran los espectros de emisión a lo largo de 24 horas de reacción. Se puede observar la presencia de las dos bandas descritas anteriormente, una a 370 nm, asociada con la forma reducida de 3,4-DHS y la otra a 417 nm, asociada a la forma oxidada, 3,4-DHS ox. En la figura la 3.7B se muestra la variación de la intensidad de emisión de ambas bandas durante el transcurso de la reacción. La banda a 370 nm disminuye hasta casi desaparecer a los 15 minutos de reacción y se va recuperando con el tiempo, alcanzando un valor constante pasados 60 minutos. Esto se puede explicar por la formación de un complejo entre el 3,4-DHS y los iones de oro, y a que, a medida que el oro se va reduciendo, el 3,4-DHS se libera y se 178

190 Intensidad Intensidad Síntesis de nanopartículas de oro con 3,4-DHS recupera la fluorescencia. Esto concuerda con el proceso de nucleación descrito por Turkevich, según el cual los iones de oro forman un complejo con el agente reductor hasta alcanzar un tamaño en el que se produce la reducción a oro metálico [Turkevich, 1951]. La recuperación de la fluorescencia puede estar relacionada también con la formación de agregados J, que produce un aumento de la fluorescencia [Jelley, 1936; Kobayashi, 1996] h A 12 B t= h 2h 15min (nm) tiempo (min) Fig (A) Espectros de emisión de una solución que contiene HAuCl M y 3,4-DHS 0.1 M en agua durante 24 horas de reacción. (B) Emisión durante el transcurso de la reacción a 370 nm ( ) y a 417 nm ( ) durante 7 horas de reacción. Se puede observar también la aparición de la banda a 417 nm, que va aumentando con el tiempo al irse oxidando el 3,4-DHS en el proceso de reducción del oro e incorporación de las moléculas de 3,4-DHS ox en los agregados J. De esta manera, se forma un par aceptor-donador conjugado, lo que provoca que esta banda presente una mayor fluorescencia. 3.2 Caracterización de las nanopartículas sintetizadas Caracterización mediante espectrofotometría Las AuNPs sintetizadas se encuentran rodeadas por moléculas de 3,4-DHS formando nanoestructuras AuNPs-DHS. Para eliminar las moléculas de 3,4-DHS que no se 179

191 Absorbancia Intensidad Resultados y discusión. Capítulo 3 encuentran fuertemente adsorbidas se centrifugó la disolución y se estudiaron las características tanto del filtrado, como del precipitado. 1.5 A 20 B (nm) (nm) Fig Espectros de absorción (A) y emisión (B) de las nanopartículas sintetizadas tras su centrifugación: filtrado ( ) y precipitado ( ). En el espectro de absorción del filtrado (figura 3.8A ) prácticamente no se observa la banda de plasmón superficial, lo que significa ausencia de AuNPs. En el espectro de emisión (figura 3.8B ) se observa principalmente la banda a 417 nm y un hombro a 370 nm. La primera corresponde a los agregados J formados por 3,4-DHS ox y la segunda, a las moléculas de 3,4-DHS sin reaccionar. Por el contrario, el precipitado de AuNPs-DHS, resuspendido en agua tras la centrifugación, muestra la característica banda de plasmón superficial (figura 3.8A ), indicando la presencia de las AuNPs. El espectro de emisión (figura 3.8B ) muestra una banda a 370 nm, asociada a las moléculas de 3,4-DHS unidas al oro y un hombro a 417 nm, asociado a las moléculas de 3,4-DHS ox que se encuentran formando agregados J sobre las nanopartículas. De acuerdo con estos resultados, se puede concluir que las moléculas de 3,4-DHS recubren a las AuNPs y se rodean de agregados de 3,4-DHS ox. 180

192 Síntesis de nanopartículas de oro con 3,4-DHS Caracterización mediante espectroscopía de infrarrojo (FTIR) La caracterización estructural de las nanopartículas obtenidas se realizó mediante espectroscopía infrarroja con transformada de Fourier (FTIR). El espectro de infrarrojo de las nanoestructuras AuNPs-DHS (figura 3.9) muestra las bandas características asociadas a los modos vibracionales de los grupos fenólicos y azometino, pero cabe destacar que también se observan bandas asociadas a grupos benzoquinona. La banda a 1665 cm -1 se asigna a la tensión de CH=N y las bandas a 1600, 1493 y 1452 cm -1 corresponden a los modos vibracionales de -C=C- aromáticos y C-O del anión fenolato. La aparición de bandas de absorción alrededor de 1730 cm -1 y de la banda a 1705 cm -1 se atribuyen al grupo C=O de la quinona. Las bandas en la región de cm -1 se asignaron a las tensiones C-O del grupo fenolato Número N o de de onda (cm (cm -1 ) -1 ) Fig Espectro FTIR de las nanopartículas sintetizadas. Llama la atención que no se observa ninguna banda de absorción del grupo -OH [Abad, 2011], lo que indica que las hidroquinonas se encuentran en forma de fenolatos. Finalmente, las bandas a 3054, 2919 y 2850 cm -1 corresponden a los modos vibracionales ν sim (-CH) del anillo aromático, ν asim (-CH 2 ) y ν sim (-CH 2 ), respectivamente. 181

193 Resultados y discusión. Capítulo 3 Tabla 3.1. Modos vibracionales presentes en el espectro FTIR de las AuNPs-DHS. banda IR (cm -1 ) modo vibracional C-O 1452, 1493 C-O C=C CH=N 1705, 1730 C=O CH 2 asim CH 2 sim CH sim Estos resultados confirman la composición de las nanopartículas modificadas con 3,4-DHS deducida con base en los estudios de absorción y fluorescencia realizados y discutidos en el apartado anterior Caracterización mediante espectroscopía Raman La espectroscopía Raman detecta los modos vibracionales de los grupos funcionales de las moléculas. La espectroscopía Raman amplificada en superficie (SERS) consiste en el aumento de la intensidad Raman de las moléculas situadas en la proximidad de una superficie metálica, basada en la amplificación del campo electromagnético efectivo en la superficie de nanoestructuras metálicas. Así, cuando la longitud de onda de excitación entra en resonancia con el plasmón de las nanopartículas, los modos localizados del plasmón superficial se excitan y se induce un fuerte campo electromagnético en la superficie metálica. Las variaciones en la intensidad Raman de los diferentes modos en los espectros SERS se explican de acuerdo a la reglas de selección [Gao, 1990]. De esta manera, se pueden caracterizar las moléculas según su orientación con respecto a la superficie metálica. La amplificación de los modos activos en Raman depende de los componentes paralelo y perpendicular a la superficie del campo electromagnético. Únicamente se observarán las vibraciones con un dipolo dinámico normal a la superficie. En general, los modos Raman con una orientación paralela a la superficie son indetectables o producen una señal muy débil [Cialla, 2014]. 182

194 Síntesis de nanopartículas de oro con 3,4-DHS Con el objetivo de determinar la orientación de las moléculas del 3,4-DHS sobre la superficie de las AuNPs, se registró el espectro SERS de las AuNPs-DHS sintetizadas. Este espectro se comparó con el espectro Raman de 3,4-DHS para diferenciar cuáles son los modos activos e inactivos en SERS. Se utilizó un láser de excitación de 785 nm, ya que si se utilizara una longitud de onda más corta, la fluorescencia del 3,4-DHS enmascararía la señal Raman. Ambos espectros se muestran en la figura Número N o de de onda onda (cm (cm -1 ) -1 ) Fig Espectros Raman de las AuNPs-DHS sintetizadas ( ) y de 3,4-DHS ( ). La asignación de bandas se realizó mediante comparación con una molécula similar [de Toledo, 2015]. Para el cálculo teórico se utilizó el programa Gaussian 09 [Frisch, 2009], utilizando Teoría del Funcional de la Densidad (DFT) con el funcional B3LYP y empleando la base 6-31G**. Los modos vibracionales se han referido a la numeración de los átomos de carbono de la estructura de la molécula de 3,4-DHS de la figura Para mayor claridad, se ha dividido la molécula mediante un plano de simetría, ya que los grupos funcionales duplicados producen los mismos modos vibracionales. 183

195 Resultados y discusión. Capítulo 3 H H C12 C13 C11 OH H C5 H H C6 C1 C8 C7 N C9 H C10 OH H C4 C3 H C2 N OH OH Fig Representación esquemática de los átomos que forman el 3,4-DHS. La línea gris representa un plano de simetría. En la tabla 3.2 se recogen las bandas presentes en los espectros Raman y SERS del 3,4-DHS y de las AuNPs-DHS, respectivamente. Las bandas entre 280 y 365 cm -1 corresponden a la torsión C-C=C-C de la imina y el anillo fenólico. Las bandas entre 385 y 505 cm -1 se asocian a las flexiones C=C-O y C-C=C de la imina y el anillo fenólico. La banda alrededor de 790 cm -1 se debe a la torsión C-C=C-H de los anillos fenólicos y la banda alrededor de 1070 cm -1, así como la banda a 1482 cm -1, a la flexión C=C-H del anillo central. Las bandas entre 1180 y 1324 cm -1 se asignan a la tensión C=C del enlace opuesto al que une los dos carbonos unidos al oxígeno, a la flexión C=C-H del anillo fenólico y a la tensión C-O. La banda centrada a 1604 cm -1 se debe a la tensión C=C del anillo central. Todas estas bandas aparecen en ambos espectros. Sin embargo, las bandas a 831, 1423 y 1448 cm -1, correspondientes a la torsión de C=C-O-H, a la flexión N=C-H y a la flexión C-O-H, respectivamente, no aparecen en el espectro SERS de las AuNPs-DHS. La ausencia de las bandas del grupo OH ya se observó en el estudio mediante FTIR y se puede explicar por la unión del 3,4-DHS a las AuNPs a través del O de fenolato. La ausencia de la banda de flexión N=C-H en el espectro SERS significa que este modo vibracional sucede de manera paralela a la superficie de las nanopartículas. Esto indica que las moléculas de 3,4-DHS se unen al oro a través de los oxígenos y se colocan de manera perpendicular a la superficie de la nanopartícula. 184

196 Síntesis de nanopartículas de oro con 3,4-DHS Tabla 3.2. Modos vibracionales presentes en el espectro Raman del 3,4-DHS y en el espectro SERS de las AuNPs-DHS (ν, tensión; δ, flexión; τ, torsión). Los parámetros de medida son: potencia de láser de 2 mw, tiempo de integración de 0.5 s y objetivo 50x. modo vibracional banda Raman 3,4-DHS (cm -1 ) SERS AuNPs-DHS (cm -1 ) τ C 7 -C 8 =C 13 -C δ C 7 -C 8 =C δ C 9 =C 10 -O, C 12 =C 11 -O τ C 10 -C 11 =C 12 -H τ C 9 =C 10 -O-H, C 12 =C 11 -O-H δ C 5 =C 6 -H ν C 8 =C δ C 12 =C 13 -H ν C 10 -O, C 11 -O δ N=C 7 -H δ C 10 -O-H, C 11 -O-H δ C 4 =C 5 -H ν C 1 =C Los resultados obtenidos mediante FTIR y Raman confirman que las nanopartículas de oro se encuentran rodeadas por moléculas de 3,4-DHS quimisorbidas a través de los grupos fenolato y que las moléculas de 3,4-DHS ox forman una capa alrededor de ellas, como se muestra en la figura 3.12, dando lugar a la formación de agregados J. Fig Representación esquemática de la disposición de las moléculas de 3,4-DHS sobre las nanopartículas. 185

197 Resultados y discusión. Capítulo Caracterización mediante microscopía electrónica de transmisión (TEM) Se realizó también una caracterización morfológica de las nanopartículas sintetizadas. En las imágenes de microscopía electrónica de transmisión (TEM) de la figura 3.13, se puede observar que las AuNPs sintetizadas muestran una buena monodispersidad y presentan una forma aproximadamente esférica, con un grado de facetado debido a su naturaleza cristalina. Además, las nanopartículas aparecen como estructuras aisladas sin formar agregados, lo que confirma que el 3,4-DHS actúa efectivamente como estabilizante de las partículas generadas, además de como reductor. Fig Imágenes de TEM de las nanopartículas sintetizadas. El tamaño de diámetro medio determinado a partir de las imágenes de TEM fue de 33 ± 3 nm. Este tamaño es cercano al calculado teóricamente a partir de la relación de absorbancias medidas a 534 nm (en la banda del plasmón superficial) y a 450 nm [Haiss, 2007], como se describe en la sección de materiales y métodos. 3.3 Propiedades electrocatalíticas de las plataformas CSPEs/AuNPs-DHS Las nanoestructuras AuNPs-DHS preparadas presentan grupos quinona expuestos a la disolución, por lo que pueden mostrar actividad electrocatalítica frente a moléculas de interés, tales como NADH o hidrazina [Revenga-Parra, 2005; Bravo, 2015]. Las nanopartículas de oro, por su parte, también presentan actividad electrocatalítica, por ejemplo, frente a la reducción de oxígeno [Shim, 2011; Hernández, 2005] o peróxido 186

198 I ( A) Síntesis de nanopartículas de oro con 3,4-DHS de hidrógeno [Das, 2008]. Por estos motivos, la modificación de electrodos con estas nanoestructuras puede ser valiosa para el desarrollo de nuevas plataformas nanoestructuradas con aplicaciones en procesos catalíticos y sensores. Con este propósito, se modificaron electrodos serigrafiados de carbono (CSPEs) con las nanoestructuras AuNPs-DHS por adsorción directa de la dispersión coloidal sobre la superficie del electrodo y se estudió la respuesta ciclovoltamperométrica de los electrodos nanoestructurados resultantes Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica En la figura 3.14 se muestra el voltamperograma del electrodo nanoestructurado con AuNPs-DHS (CSPEs/AuNPs-DHS) en NaOH 0.1 M. Se puede observar el par redox característico, con picos anódico y catódico centrados en y V, respectivamente, asociado a la oxidación/reducción de los grupos quinona/hidroquinona del 3,4-DHS E (V) Fig Voltamperograma cíclico de CSPE/AuNPs-DHS en NaOH 0.1 M a 10 mv s Efecto del ph Se estudió la influencia del ph en la respuesta ciclovoltamperométrica de los electrodos nanoestructurados con AuNPs-DHS, debida a los grupos quinona/hidroquinona del 3,4-DHS. 187

199 E 0 ' (V) Resultados y discusión. Capítulo 3 Como era de esperar para sistemas redox que implican protones, a medida que aumenta el ph del medio, los potenciales formales se desplazan a valores más negativos (figura 3.15A). 2 A 0.2 B I ( A) E (V) ph Fig (A) Voltamperogramas cíclicos de CSPEs/AuNPs-DHS a diferentes phs: 5.0 ( ), 7.0 ( ), 9.0 ( ), 11.2 ( ) y 13.0 ( ) a 10 mv s -1. (B) Dependencia lineal del potencial formal con el ph. La representación del potencial formal (E 0 ) frente al ph presenta una relación lineal (figura 3.15B). El valor de la pendiente, mv/unidad de ph, indica que se intercambia el mismo número de protones que de electrones, en este caso dos protones y dos electrones por cada grupo quinona/hidroquinona Efecto de la velocidad de barrido Con el fin de conocer más profundamente el sistema, se estudió la respuesta voltamperométrica de los electrodos nanoestructurados en función de la velocidad de barrido. En los voltamperogramas cíclicos en tampón fosfato 0.1 M ph 7.0 a velocidades de barrido inferiores a 0.6 V s -1 de la figura 3.16A se puede apreciar que el potencial formal (E 0 =0.08 V) es prácticamente constante a velocidades inferiores a 0.6 V s -1. Las intensidades de pico anódico y catódico presentan una dependencia lineal con la velocidad de barrido en el intervalo estudiado, como se espera de un par redox confinado en la superficie del electrodo (figura 3.16B). 188

200 I ( A) I (µa) Síntesis de nanopartículas de oro con 3,4-DHS 4 2 A 0.6 V s V s B v (Vs -1 ) E (V) -2 Fig (A) Voltamperogramas cíclicos de CSPEs/AuNPs-DHS a ph 7.0 a velocidades de barrido inferiores a 0.6 V s -1. (B) Variación de la intensidad de corriente anódica ( ) y catódica ( ) con la velocidad de barrido. En la figura 3.17A se muestran los voltamperogramas para velocidades de barrido más elevadas. La separación de picos (ΔEp) es 0.11 V, lejos del valor 0 esperado para un proceso redox reversible confinado en la superficie del electrodo y aumenta significativamente para velocidades de barrido superiores a 1 V s -1, lo que sugiere limitaciones severas en la transferencia de carga (figura 3.17B) a estas altas velocidades. 189

201 E p (V) E p (V) Resultados y discusión. Capítulo A 20 V s B I ( A) V s log v 0.2 C log v E (V) Fig (A) Voltamperogramas cíclicos de CSPEs/AuNPs-DHS a ph 7.0 a velocidades de barrido superiores a 0.8 V s -1. (B) Variación del potencial de pico anódico ( ) y catódico ( ) con el logaritmo de la velocidad de barrido para CSPEs/AuNPs-DHS modificados con 3,4-DHS a ph 7.0 a diferentes velocidades de barrido. (C) Ampliación para velocidades de barrido superiores a 8 V s -1. Los potenciales de pico anódico y catódico se representaron frente al logaritmo de la velocidad (figura 3.17C) en el típico gráfico de Laviron [Laviron, 1979]. A velocidades de barrido superiores a 8 V s -1, los potenciales de pico presentan una dependencia lineal con el logaritmo de la velocidad. A partir de las pendientes de esas rectas se calcularon el coeficiente de transferencia de carga (α) y la constante heterogénea de transferencia de carga (k s ). Los valores obtenidos fueron 0.50 y 47 s -1, respectivamente. El valor de k s para AuNPs-DHS es mayor que el obtenido con rgo-dhs de 8.92 s -1, lo que se puede explicar teniendo en cuenta el carácter metálico del oro depositado sobre el carbono. El valor de α indica que se trata de un proceso totalmente reversible, ya que la oxidación y la reducción están favorecidas por igual Oxidación electrocatalítica de hidrazina Se estudió la actividad electrocatalítica de los electrodos nanoestructurados con AuNPs-DHS frente a la oxidación de hidrazina mediante voltamperometría cíclica. 190

202 I ( A) Síntesis de nanopartículas de oro con 3,4-DHS Existen ejemplos en la bibliografía en los que la mejor respuesta electrocatalítica de diferentes electrodos modificados frente a la catálisis de esta molécula se observa a ph básico [Ozoemena, 2006; Zhang, 1996; Isaacs, 1998; Li, 2003], por lo que el estudio se llevó a cabo en NaOH 0.1 M. En estas condiciones, la hidrazina, que tiene un pk a de 7.9 [Adams, 1963], se encuentra desprotonada, por tanto, la oxidación sucede de acuerdo con la reacción: N 2 H 4 + 4OH - N 2 + 4H 2 O + 4e - En los voltamperogramas de la figura 3.18 se puede observar que, en ausencia de hidrazina ( ), la respuesta del electrodo modificado muestra el par redox característico del 3,4-DHS. La adición de hidrazina ( ) provoca un drástico incremento de la corriente anódica, además de una disminución en la corriente catódica, lo que es característico de un potente efecto electrocatalítico. Además, el pico de oxidación de la hidrazina aparece a un potencial de -0.2 V, correspondiente a la señal del 3,4-DHS. Este valor es mucho más bajo que el que se obtiene al oxidar esta molécula en un electrodo sin modificar (figura 3.19A) o modificada con 3,4-DHS (figura 3.19B), para los que no se observa el pico de oxidación en el intervalo de potencial estudiado E (V) Fig Voltamperogramas cíclicos de CSPE/AuNPs-DHS en ausencia ( ) y en presencia de hidrazina 60 μm ( ) en NaOH 0.1 M a 10 mv s

203 I ( A) Resultados y discusión. Capítulo 3 En este último caso, la ausencia de onda de oxidación puede ser debida a que en el medio básico fuerte en el que se está trabajando el 3,4-DHS puede desprenderse de la superficie del electrodo, por lo que el electrodo se comportaría como un electrodo no modificado. En las AuNPs-DHS el 3,4-DHS se encuentra fuertemente unido, como se demostró en los estudios anteriores y, por tanto, permanece unido aun en medio muy básico. A B E (V) E (V) Fig Voltamperogramas cíclicos de CSPEs (A) no modificado y (B) modificado con 3,4-DHS en ausencia ( ) y en presencia de hidrazina 1 mm ( ) en NaOH 0.1 M a 10 mv s -1. Los resultados obtenidos confirman que la nanoestructuración de CSPEs con AuNPs-DHS da lugar a plataformas con una buena actividad electrocatalítica para la oxidación de hidrazina Efecto del ph en la oxidación catalítica de hidrazina El hecho de que en la reacción de oxidación, tanto de la hidrazina como del 3,4-DHS haya protones involucrados, hace que sea necesario optimizar el valor de ph al que se lleva a cabo la determinación. Para ello, se estudió la respuesta voltamperométrica de los CSPEs nanoestructurados con AuNPs-DHS frente a disoluciones de hidrazina 1.0 mm a diferentes valores de ph. En la figura 3.20 se muestran los barridos anódicos para mayor claridad. 192

204 I ( A) Síntesis de nanopartículas de oro con 3,4-DHS E (V) Fig Barridos anódicos de CSPEs/AuNPs-DHS en presencia de 1.0 mm de hidrazina a diferentes valores de ph: 3.0 ( ), 5.0 ( ), 7.0 ( ), 9.0 ( ), 11.2 ( ) y 13.0 ( ) a 10 mv s -1. Se puede observar que la mayor intensidad se obtiene para ph 13.0, por lo que se utilizará este ph para el desarrollo del sensor de hidrazina Efecto de la velocidad de barrido en la oxidación catalítica de hidrazina Para analizar el proceso catalítico y determinar el mecanismo por el que transcurre la electrooxidación de hidrazina, se estudió la respuesta de los electrodos nanoestructurados con AuNPs-DHS en función de la velocidad de barrido. En la figura 3.21A se muestran los voltamperogramas cíclicos correspondientes a la oxidación electrocatalítica de hidrazina 1.0 mm en NaOH 0.1 M sobre los CSPEs/AuNPs-DHS a diferentes velocidades de barrido (v). Se puede observar un desplazamiento del pico anódico hacia potenciales más altos a medida que aumenta v, lo que sugiere la existencia de limitaciones cinéticas en la transferencia de carga. La relación lineal observada en la representación de la intensidad de pico catalítico frente a la raíz cuadrada de la velocidad de barrido (figura 3.21B) indica que el proceso catalítico está limitado por la difusión de la hidrazina hacia la superficie del electrodo. 193

205 I ( A) Resultados y discusión. Capítulo A 0.2 Vs Vs -1 I ( A) I CAT /v 1/ v 1/2 (mv 1/2 s -1/2 ) B r=0.996 C v (mvs -1 ) E (V) Fig (A) Voltamperogramas cíclicos de la oxidación de hidrazina 1.0 mm en NaOH 0.1 M sobre CSPEs/AuNPs-DHS a diferentes velocidades de barrido. (B) Representación de la corriente catalítica en función de la raíz cuadrada de la velocidad de barrido. (C) Representación de la corriente catalítica normalizada con la raíz cuadrada de la velocidad en función de la velocidad de barrido. Al representar la corriente normalizada con la raíz cuadrada de la velocidad de barrido frente a la velocidad de barrido (figura 3.21C) se obtiene la típica curva de un mecanismo EC catalítico [Nicholson, 1964], al igual que en el caso de rgo-dhs. Así, el mecanismo según el cual ocurre la oxidación electrocatalítica de hidrazina es el que se representa en el esquema de la figura 3.22, donde la reducción de las quinonas por parte de la hidrazina reinicia el ciclo catalítico. Hidroquinona-AuNPs Quinona-AuNPs - 4e H + k cat N 2 + 4H 2 O + 4e - N 2 H 4 + 4OH - Fig Esquema del mecanismo catalítico de la oxidación de hidrazina sobre las plataformas AuNPs-DHS. 194

206 pendientes Síntesis de nanopartículas de oro con 3,4-DHS Determinación de la constante catalítica para hidrazina Se estimó la constante catalítica (k cat ) para la reacción entre la hidrazina y los electrodos nanoestructurados utilizando cronoamperometría de un solo pulso siguiendo el método de Galus [Galus, 1991], según se describe en materiales y métodos. Al representar I CAT /I D frente a la raíz cuadrada del tiempo de medida para distintas concentraciones de hidrazina (figura 3.23) se obtienen líneas rectas. De la representación de las pendientes de las rectas frente la raíz cuadrada de la concentración (fig inserto) se calcula la constante catalítica. En este caso, se obtuvo un valor de 6.4 x10 6 M -1 s -1. Este valor de la constante es varios órdenes de magnitud mayor que los que se encuentran en la bibliografía para otros sensores de hidrazina basados en electrodos modificados [Nassef, 2006; Ozoemena, 2006; Foster, 2014; Sun, 2013; Tan, 2013; Bravo, 2015] y es también superior a los obtenidos para las plataformas desarrolladas por nanoestructuración de CSPEs mediante diazotación y electroinjerto de nanotubos de carbono aminados en combinación con 3,4-DHS (2.93 x10 6 M -1 s -1 ) o por nanoestructuración de CSPEs con rgo-dhs (2.2 x10 6 M -1 s -1 ), demostrando así la extraordinaria eficiencia catalítica de estos electrodos modificados promovida por las nanoestructuras AuNPs-DHS I CAT /I D c 1/2 (M 1/2 ) t 1/2 (s 1/2 ) Fig Representación de I CAT /I D frente a t 1/2 para hidrazina sobre CSPEs/AuNPs-DHS. Inserto: Representación de las pendientes de las rectas frente a la raíz cuadrada de la concentración. 195

207 I ss ( A) Resultados y discusión. Capítulo Propiedades analíticas del sensor de hidrazina Para determinar las propiedades del sensor de hidrazina, se llevaron a cabo experimentos cronoamperométricos pulsando el potencial desde V hasta 0.0 V en disolución no agitada (figura 3.24). La corriente de estado estacionario se alcanza en pocos segundos, lo que confirma la rápida respuesta del sensor. Dicha corriente muestra una relación lineal (y=2.13 x10-2 x , R 2 = 0.996) con la concentración de hidrazina hasta 4.0 mm (figura 3.24 inserto) mm 0 I ss ( A) [N 2 H 4 ] (mm) t (s) Fig Cronoamperogramas de la oxidación de hidrazina sobre CSPEs/AuNPs-DHS a ph Inserto: Corriente en el estado estacionario (I ss ) a 38 segundos frente a la concentración de hidrazina. La sensibilidad, determinada por la pendiente de esta recta, es (2.13 ± 0.03) x10-2 μa μm -1. Los límites de detección y cuantificación, calculados como las concentraciones de hidrazina que generan una señal igual a tres o diez veces la desviación estándar de la corriente del blanco, se estimaron en 22 y 70 nm, respectivamente, como se recoge en la tabla

208 Síntesis de nanopartículas de oro con 3,4-DHS Tabla 3.3. Parámetros analíticos obtenidos para la oxidación electrocatalítica de hidrazina sobre CSPEs nanoestructurados con AuNPs-DHS. Límite de detección (nm) Límite de cuantificación (nm) Intervalo lineal (mm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) Estabilidad hasta x semanas Este límite de detección es inferior al encontrado en la bibliografía para sensores de hidrazina basados en electrodos modificados con moléculas electroactivas y nanopartículas de oro. Algunos ejemplos son el trabajo de Saengsookwaow [Saengsookwaow, 2016], donde se describe un sensor de hidrazina basado en la modificación de un electrodo serigrafiado de carbono con un compósito de grafeno dopado con nitrógeno y polivinilpirrolidona y AuNPs electrodepositadas, en el que se alcanza un límite de detección de 70 nm, o los de Koçak, donde se describen sensores de hidrazina basados en la modificación de un electrodo de carbón vítreo con taurina electropolimerizada y AuNPs electrorreducidas [Koçak, 2016] o en la modificación de un electrodo de carbón vítreo con nanotubos de carbono, púrpura de bromocresol electropolimerizado y AuNPs electrorreducidas [Koçak, 2014], alcanzándose límites de detección de 50 y 100 nm, respectivamente. Se evaluó la reproducibilidad a partir de la R.S.D. de la respuesta de tres electrodos distintos. En este caso, para una concentración de 20 µm, se obtuvo una R.S.D. de 4.9 %, inferior al valor de CV H de 10.2 CV H calculado para esa concentración [Wood, 1999], confirmando la buena reproducibilidad del sensor desarrollado. Para evaluar la estabilidad de este sensor se estudió su respuesta en presencia de hidrazina 1.0 mm tras 6 semanas de almacenamiento a temperatura ambiente, observándose que se mantenía constante durante ese tiempo. Si se compara este sensor de hidrazina con los otros descritos en esta memoria basados en la nanoestructuración de CSPEs, bien mediante diazotación y electroinjerto de MWCNTs y posterior modificación con 3,4-DHS o por adsorción directa de rgo-dhs se observa que la nanoestructuración con AuNPs-DHS permite conseguir el límite de detección más bajo, con un intervalo lineal más amplio y una mayor sensibilidad (tabla 3.4). 197

209 Resultados y discusión. Capítulo 3 Tabla 3.4. Comparación de los parámetros analíticos obtenidos para la oxidación electrocatalítica de hidrazina para CSPEs nanoestructurados con diferentes nanomateriales. Modificación Límite de detección (μm) Intervalo lineal (mm) Sensibilidad (μa/μm) MWCNTs + 3,4-DHS x10-2 rgo-dhs 0.20 hasta x10-2 AuNPs-DHS hasta x Oxidación electrocatalítica de peróxido de hidrógeno El peróxido de hidrógeno (H 2 O 2 ) es un líquido incoloro a temperatura ambiente, de olor penetrante y soluble en agua. Aunque presenta unas propiedades físicas similares al agua, químicamente se diferencian en que el H 2 O 2 se comporta como un ácido débil debido a la presencia del segundo átomo de oxígeno. Entre sus aplicaciones destaca su uso como blanqueante industrial de papel, madera o textiles, aunque también se utiliza para el blanqueo de alimentos y como blanqueante dental. También se emplea como agente bacteriostático, ya que altera la conformación de las enzimas bacterianas, y desinfectante, debido al desprendimiento de oxígeno provocado por la descomposición del H 2 O 2 por las enzimas catalasas presentes en las células. A nivel biológico, el H 2 O 2 es un subproducto de la reacción enzimática catalizada por las enzimas oxidasas, por lo que su determinación es de gran importancia en el desarrollo de biosensores basados en este tipo de enzimas, ya que su concentración es directamente proporcional a la cantidad de sustrato transformado por la enzima. Otra característica del H 2 O 2 es que puede actuar como agente oxidante o como reductor tanto en medio ácido como básico. [Harris, 2007]. Concretamente, la oxidación electrocatalítica de H 2 O 2 en medio básico es una reacción de gran interés en el desarrollo de futuras celdas de combustible [Yamada, 2010]. Típicamente, el oro policristalino presenta una pobre actividad catalítica frente a la oxidación de H 2 O 2, tanto en medio ácido como básico. Sin embargo, las AuNPs 198

210 I ( A) Síntesis de nanopartículas de oro con 3,4-DHS muestran interesantes propiedades electrocatalíticas, como se ha comentado anteriormente, frente a la reducción de oxígeno [Hernández, 2005; Shim, 2011] o a la oxidación de peróxido de hidrógeno [Das, 2008]. Por este motivo se estudió la capacidad de las AuNPs-DHS sintetizadas para actuar como catalizador en la oxidación y reducción de peróxido de hidrógeno. En la figura 3.25 ( ) se muestra el voltamperograma cíclico de un CPSE nanoestructurado con AuNPs-DHS en una disolución de NaOH 0.1 M en presencia de H 2 O mm. En el voltamperograma se puede ver un pico catódico bien definido a V y otro anódico a 0.04 V, a diferencia del electrodo no modificado (figura 3.25 ), para el que, en presencia de H 2 O 2, no se observa ningún pico de oxidación o reducción E (V) Fig Voltamperogramas cíclicos de CSPEs/AuNPs-DHS en presencia de H 2 O mm ( ) y 22.0 mm ( ) y CSPE no modificado en presencia de H 2 O mm ( ) en NaOH 0.1 M a velocidad 10 mv s -1. El proceso anódico observado corresponde a la oxidación electroquímica de H 2 O 2 a O 2. El pico catódico se puede asignar a la reducción de oxígeno, producido por la descomposición catalítica de H 2 O 2 en contacto con electrodos de oro [Miah, 2006; Merkulova, 1973; Goszner, 1974; McKee, 1969; Bianchi, 1962; Ishtchenko, 2003]. Tanto el pico de oxidación como el de reducción aumentan al aumentar la concentración de H 2 O 2. Se observa además que la curva adquiere una forma 199

211 Resultados y discusión. Capítulo 3 sigmoidal, lo que significa que la velocidad de transferencia electrónica es muy elevada y el proceso está controlado por la difusión de H 2 O 2 hacia el electrodo, alcanzándose una corriente límite de difusión (figura 3.25 ). En estas condiciones, en ausencia de agitación, la aparición de esta corriente límite de difusión, característica de una difusión hemiesférica en lugar de una planar, se explicaría considerando el electrodo modificado con las AuNPs como un conjunto de nanoelectrodos esféricos [Murray, 2008; Arrigan, 2004] Efecto del ph en la oxidación catalítica de peróxido de hidrógeno Al igual que en el caso de la oxidación de hidrazina, en la reacción de oxidación de H 2 O 2 hay protones involucrados, por lo que se estudió la influencia del ph. En la figura 3.26 se muestran los barridos anódicos de la respuesta voltamperométrica de los CSPEs nanoestructurados con AuNPs-DHS en presencia de H 2 O mm a diferentes valores de ph. 15 I ( A) E (V) Fig (A) Barridos anódicos de CSPEs/AuNPs-DHS en presencia de H 2 O mm a diferentes valores de ph: 5.0 ( ), 7.0 ( ), 9.0 ( ), 11.2 ( ) y 13.0 ( ) a 10 mv s -1. (B) Variación de la corriente electrocatalítica en función del ph. En este caso se observan dos máximos de intensidad, a ph 7.0 ( ) y ph 13.0 ( ). Teniendo en cuenta otros sensores de H 2 O 2 descritos en la bibliografía donde la 200

212 Síntesis de nanopartículas de oro con 3,4-DHS detección se realiza en medio básico [Miah, 2006; Yang, 2012b], se eligió ph 13.0 como ph de trabajo en el desarrollo del sensor de H 2 O Efecto de la velocidad de barrido en la oxidación catalítica de peróxido de hidrógeno Como en el caso de la hidrazina, para elucidar el mecanismo, se estudió el efecto de la velocidad de barrido en la electrooxidación del H 2 O 2 mediante voltamperometría cíclica. En las figura 3.27A se puede observar que la intensidad de pico catalítico presenta una relación lineal con la raíz cuadrada de la velocidad de barrido, lo que indica que es un proceso controlado por difusión, es decir, la difusión del H 2 O 2 hacia la superficie del electrodo. 150 A 50 B I ( A) 100 I CAT /v 1/ v 1/2 (mv 1/2 s -1/2 ) v (mvs -1 ) Fig (A) Representación de la corriente catalítica en función de la raíz cuadrada de la velocidad de barrido para la oxidación de H 2 O mm en NaOH 0.1 M sobre CSPEs/AuNPs-DHS a diferentes velocidades de barrido. (B) Representación de la corriente catalítica normalizada con la raíz cuadrada de la velocidad en función de la velocidad de barrido. Además, la curva obtenida de la representación de la corriente normalizada con la raíz cuadrada de la velocidad de barrido frente a la velocidad de barrido (figura 3.27B) indica que el mecanismo a través del que transcurre la reacción es de tipo EC catalítico [Nicholson, 1964], en el que la reacción de oxidación está mediada por las nanopartículas de oro recubiertas con 3,4-DHS. 201

213 pendientes pendientes Resultados y discusión. Capítulo Determinación de la constante catalítica para peróxido de hidrógeno Se calcularon las constantes catalíticas para las reacciones de oxidación y reducción de H 2 O 2 mediante medidas cronoamperométricas de un solo pulso aplicando potenciales desde -0.6 V hasta +0.3 V y -0.3 V para la electrooxidación y electrorreducción, respectivamente, siguiendo el procedimiento descrito por Galus [Galus, 1991], de la misma manera que se hizo en el caso de la hidrazina A B I CAT /I D c 1/2 (M) 1/2 I CAT /I D c 1/2 (M) 1/ t 1/2 (s 1/2 ) t 1/2 (s 1/2 ) Fig Representación de I CAT /I D frente a t 1/2 para (A) la oxidación y (B) la reducción de H 2 O 2 sobre CSPEs/AuNPs-DHS. Inserto: Representación de las pendientes de las rectas frente a la raíz cuadrada de la concentración. En las figuras 3.28A y B se muestran las representaciones de la relación I CAT /I D obtenidas para la oxidación y reducción de distintas concentraciones de H 2 O 2, respectivamente. A partir de la pendiente obtenida de la representación de las pendientes de estas rectas frente a la raíz cuadrada del tiempo se obtuvieron los valores de la constante catalítica, en este caso, 1.9 x10 5 M -1 s -1 para la oxidación y 5.1 x10 5 M -1 s -1 para la reducción de H 2 O 2. Estos valores son varios órdenes de magnitud superiores a los valores de k cat descritos para otros sistemas electrocatalíticos para la reducción u oxidación de H 2 O 2 [Iveković, 2010; Ojani, 2010]. Esto indica que las AuNPs sintetizadas presentan una fuerte actividad electrocatalítica tanto frente a la oxidación, como a la reducción de H 2 O

214 Síntesis de nanopartículas de oro con 3,4-DHS Propiedades analíticas del sensor de peróxido de hidrógeno Se ha observado previamente (figura 3.25) que las corrientes de pico anódica y catódica aumentan al aumentar la concentración de H 2 O 2, por lo que las plataformas nanoestructuradas desarrolladas pueden ser empleadas como sensores de H 2 O 2 midiendo su oxidación o reducción. Para determinar las propiedades analíticas del sensor se realizaron medidas cronoamperométricas frente a concentraciones crecientes de analito. En el caso de la oxidación, se aplicó un potencial de +0.3 V y los cronoamperogramas obtenidos se muestran en la figura 3.29A. En la representación de la corriente en estado estacionario a 38 s frente a la concentración de H 2 O 2 (figura 3.29A inserto) se observa una relación lineal (y=9.24 x10-3 x x10-2, R 2 = 0.998) hasta 14 mm. La sensibilidad obtenida fue (9.24 ± 0.03) x10-3 μa μm -1 y los límites de detección y cuantificación, calculados con el criterio de 3 y 10 veces la desviación estándar del blanco, se estimaron en 0.15 y 0.51 μm, respectivamente. 600 A I ss ( A) mm 0 I ss ( A) [H 2 O 2 ] (mm) I ss ( A) t (s) 0 70 mm B I ss ( A) [H 2 O 2 ] (mm) t (s) Fig Cronoamperogramas de (A) oxidación y (B) reducción de H 2 O 2 sobre CSPEs/AuNPs-DHS a ph Inserto: Corriente en el estado estacionario (I ss ) a 38 segundos frente a la concentración de H 2 O 2. Para el proceso de electrorreducción a -0.3 V (figura 3.29B), se observa que los electrodos nanoestructurados presentan una buena respuesta frente a la detección de H 2 O 2, con un amplio intervalo lineal (y=-6.03 x10-3 x 6.95 x10-1, R 2 = 0.996) hasta

215 Resultados y discusión. Capítulo 3 mm y una sensibilidad de (-6.03 ± 0.05) x10-3 μa μm -1. Además, se obtuvieron bajos límites de detección, 0.32 µm, y cuantificación, 1.1 μm. Los parámetros analíticos obtenidos para ambos procesos se recogen en la tabla 3.5. Tabla 3.5. Parámetros analíticos obtenidos para la oxidación y reducción electrocatalíticas de H 2 O 2 sobre CSPEs nanoestructurados con AuNPs-DHS. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (mm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) oxidación hasta x reducción hasta x Estos datos se comparan favorablemente con otros sensores de H 2 O 2 basados en electrodos modificados descritos en la bibliografía [Iveković, 2010; Ojani, 2010; Qin, 2015; Cao, 2015; Lian, 2009; Welch, 2005; Liu, 2009b; Iveković, 2012; Dutta, 2012; Salimi, 2011; Chang, 2014; Xiong, 2014]. En concreto, se obtienen mejores límites de detección y cuantificación que en el caso de electrodos modificados con compósitos de Fe 3 O 4 -Fe 2 O 3 [Cao, 2015], plata rugosada [Lian, 2009] o nanopartículas de plata [Welch, 2005]. En el caso de electrodos modificados con reactivos químicos como azul de Prusia [Liu, 2009b; Iveković, 2012; Dutta, 2012] o con un complejo de Mn-fenazina [Salimi, 2011] los límites de detección son similares a los obtenidos con las plataformas AuNPs-DHS desarrolladas, pero, en general, con los electrodos nanoestructurados con AuNPs-DHS se obtienen intervalos lineales más amplios [Chang, 2014], y requieren la aplicación de potenciales más bajos [Xiong, 2014], con la ventaja de que se pueden utilizar para detectar H 2 O 2, tanto por electrooxidación como por electrorreducción. 3.4 Desarrollo de un biosensor de lactato Al igual que en el capítulo anterior, para el desarrollo del biosensor se utilizó la enzima lactato oxidasa. En este capítulo, aprovechando las excelentes propiedades catalíticas frente a H 2 O 2 de las plataformas desarrolladas, se ha continuado con la misma enzima para desarrollar un sensor amperométrico de lactato basado en la 204

216 Síntesis de nanopartículas de oro con 3,4-DHS detección de H 2 O 2 generado en la reacción enzimática sobre CSPEs nanoestructurados con AuNPs-DHS Desarrollo y respuesta del biosensor El biosensor de lactato se preparó mediante modificación de las plataformas nanoestructuradas con AuNPs-DHS con 1.0 U de LOx, como se muestra en el esquema de la figura O 2 AuNPs-DHS ox Lactato + O 2 Piruvato + H 2 O 2 AuNPs-DHS red Fig Esquema de funcionamiento del biosensor basado en CSPE/AuNPs-DHS y LOx. La actividad catalítica del biosensor desarrollado se evaluó mediante voltamperometría cíclica en ausencia y en presencia del sustrato natural (lactato). En la figura 3.31 se puede apreciar que en ausencia de lactato ( ), se observa la respuesta electroquímica adscrita a la oxidación/reducción de los grupos quinona/hidroquinona del 3,4-DHS que recubre las AuNPs. Cuando se adiciona lactato en concentración 0.5 mm ( ) se aprecia un aumento en la corriente anódica debido a la oxidación electrocatalítica del H 2 O 2 generado en la reacción enzimática. Además, se observa una disminución en la corriente catódica, de acuerdo con un proceso electrocatalítico, que comprende una serie de reacciones en cascada, tal y como se recoge en el esquema de la figura

217 I ( A) Resultados y discusión. Capítulo E (V) Fig Voltamperogramas cíclicos de CSPEs/AuNPs-DHS modificados con LOx en ausencia ( ) y en presencia ( ) de lactato 0.5 mm tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. Según este esquema, en el funcionamiento del biosensor los electrones involucrados en la reacción se transfieren desde el sustrato (lactato) a la forma oxidada del cofactor de la enzima (flavín mononucleótido, FMN) presente en la estructura de la enzima. Para regenerar el sitio catalítico de la enzima, el oxígeno molecular toma los electrones del cofactor reducido, transformándose en peróxido de hidrógeno. El peróxido, a su vez, se reduce a oxígeno, cediendo electrones al mediador, en este caso, las nanoestructuras AuNPs-DHS, cuya oxidación produce la señal electroquímica. En el estudio de la influencia del ph en la oxidación de H 2 O 2 (figura 3.26) se observó que la respuesta de las plataformas nanoestructuradas obtenida en presencia de H 2 O mm era máxima a ph 13.0, que se usó para el desarrollo del sensor, y a ph 7.0. Dado que el correcto funcionamiento de la enzima es a ph 7.0, en este caso, la respuesta del biosensor se obtuvo utilizando como medio de trabajo tampón fosfato 0.1 M a ph 7.0. Para confirmar el papel de la enzima en la respuesta catalítica al sustrato, se estudió la respuesta de los electrodos nanoestructurados con AuNPs-DHS sobre los que no se había inmovilizado la enzima LOx. 206

218 I ( A) Síntesis de nanopartículas de oro con 3,4-DHS E (V) Fig Voltamperogramas cíclicos de CSPEs/AuNPs-DHS en ausencia ( ) y en presencia ( ) de lactato 0.5 mm tampón fosfato 0.1 M ph 7.0 a 10 mv s -1. En la figura 3.32 se puede apreciar que en presencia de lactato ( ) no se observa un aumento de la corriente anódica al comparar con el voltamperograma obtenido en ausencia de lactato ( ). Esto confirma que la respuesta del biosensor procede de la reacción enzimática Efecto de la cantidad de AuNPs-DHS Se espera que la respuesta del biosensor dependa significativamente de la cantidad de AuNPs-DHS depositadas sobre la superficie del electrodo. Por este motivo, se prepararon diferentes biosensores con concentraciones crecientes de AuNPs-DHS. En la figura 3.33 se muestran las respuestas de los biosensores preparados utilizando 20, 70 o 180 fmol de AuNPs-DHS en ausencia ( ) y en presencia ( ) de lactato 0.5 M. 207

219 I ( A) Resultados y discusión. Capítulo AuNPs-DHS (fmol) Fig Respuesta del biosensor preparado con diferentes cantidades de AuNPs en tampón fosfato 0.1 M ph 7.0 en ausencia ( ) y en presencia ( ) de lactato 0.5 mm a 5 mv s -1. La mayor respuesta catalítica se obtuvo cuando se utilizaron 180 fmol. Sin embargo, como se puede apreciar en la figura 3.33, para esa cantidad de AuNPs-DHS, la respuesta en ausencia de lactato también es muy elevada. La eficiencia catalítica, definida como la relación entre la corriente catalítica y la corriente medida para los electrodos modificados en ausencia de lactato, es mayor cuando se utilizan 70 fmol de AuNPs-DHS. Por tanto, se eligió esta cantidad para la preparación del biosensor en los siguientes estudios Efecto de la cantidad de enzima Se optimizó también la cantidad de enzima en el desarrollo del biosensor. Por este motivo, se prepararon diferentes biosensores con concentraciones crecientes de LOx. En la figura 3.34 se puede observar que la respuesta del biosensor aumenta al aumentar las unidades de enzima incluidas en la capa biosensora desde 0.3 U a 1 U. 208

220 I CAT ( A) Síntesis de nanopartículas de oro con 3,4-DHS LOx (U) Fig Respuesta del biosensor preparado con diferentes cantidades de enzima LOx en tampón fosfato 0.1 M ph 7.0 en presencia de lactato 0.5 mm a 5 mv s -1. A mayores cantidades de enzima, se produce una disminución en la respuesta del biosensor. Esto se debe probablemente a un exceso de proteína en la capa biosensora, que dificulta la transferencia de carga hacia la superficie del electrodo. De acuerdo con estos resultados, se eligió 1.0 U como la cantidad óptima de LOx Efecto del ph Se estudió el efecto del ph de la disolución en la respuesta del biosensor en el intervalo Los resultados mostrados en la figura 3.35 revelan que la respuesta aumenta al aumentar el ph, alcanzando un máximo a ph 7.0 y a valores de ph superiores la intensidad disminuye. 209

221 I CAT ( A) Resultados y discusión. Capítulo ph Fig Efecto del ph en la respuesta del biosensor en presencia de lactato 0.5 mm a 5 mv s -1. Por este motivo, se eligió el tampón fosfato 0.1 M ph 7.0 como medio de trabajo para la determinación de lactato Respuesta del biosensor Una vez optimizadas las condiciones de trabajo, se estudió la respuesta del biosensor mediante cronoamperometría, aplicando un potencial constante de +0.3 V. La figura 3.36 muestra la respuesta en función de la concentración de lactato. Se observa que la curva de calibrado se ajusta a una cinética de Michaelis-Menten. Esto confirma que la respuesta del biosensor está controlada por la reacción enzimática y que a una determinada concentración de sustrato la respuesta es independiente de esta. 210

222 Síntesis de nanopartículas de oro con 3,4-DHS 6 4 I (µa) [lactato] (mm) Fig Curva de calibrado obtenida de las medidas cronoamperométricas para CSPE/AuNPs-DHS modificado con LOx en presencia de concentraciones crecientes de lactato en tampón fosfato 0.1 M a ph 7.0. Los parámetros analíticos del biosensor se obtuvieron de la parte lineal (hasta 800 µm) de la curva de calibrado. La sensibilidad obtenida, calculada a partir de la pendiente de la recta, fue de (5.1± 0.1) x10-3 µa mm -1. Los límites de detección y cuantificación, calculados como la concentración que produce una señal igual a tres o diez veces la desviación estándar de la corriente del blanco, fueron 2.6 y 8.6 µm, respectivamente. Todos los parámetros se encuentran recogidos en la tabla 3.6. Tabla 3.6. Parámetros analíticos obtenidos para la determinación de lactato sobre CSPEs nanoestructurados con AuNPs-DHS y modificados con LOx. Límite de detección (μm) Límite de cuantificación (μm) Intervalo lineal (µm) Sensibilidad (μa/μm) Reproducibilidad (R.S.D.%) < x El límite de detección es inferior al obtenido con las plataformas basadas en la nanoestructuración de CSPEs con rgo-dhs, desarrollado en el capítulo anterior. Además, se compara favorablemente con otros biosensores de lactato basados en la 211

223 Resultados y discusión. Capítulo 3 modificación de electrodos serigrafiados con LOx descritos previamente [Loaiza, 2015; Parra, 2006a]. La reproducibilidad se evaluó comparando las señales analíticas obtenidas usando tres biosensores diferentes preparados de la misma manera. Se obtuvo un valor de la desviación estándar relativa del 8.6% para la concentración de 20 µm. Este valor es inferior al CV H calculado para esa concentración, de 10.2 [Wood, 1999], asegurando la buena reproducibilidad del biosensor desarrollado. Finalmente, se examinó la estabilidad midiendo la respuesta de tres biosensores distintos frente a 0.5 mm de lactato durante un mes. Pasado este tiempo, los biosensores mantuvieron el 85% de su respuesta original Estudio de sustancias potencialmente interferentes La presencia en las muestras reales de sustancias que puedan interferir en la respuesta del biosensor hace que sea necesario evaluar el efecto que producen en dicha respuesta. Se estudió el efecto de las sustancias potencialmente interferentes comúnmente presentes en alimentos y bebidas, como son el ácido tartárico, ácido cítrico, ácido ascórbico, ácido acético, glucosa, fructosa, etanol y metanol. Al igual que en el capítulo anterior, se encontró que la presencia de estas sustancias no afecta de manera notable a la respuesta del biosensor de lactato desarrollado, excepto en el caso del ácido ascórbico cuando se encuentra en la misma concentración que el lactato, aunque no se observó ningún efecto a concentraciones más bajas. Estos resultados aseguran que el biosensor desarrollado es muy selectivo y se puede emplear satisfactoriamente en la determinación directa de lactato en muestras reales sin la necesidad de realizar ningún paso previo de tratamiento de las mismas Determinación directa de lactato en muestras reales El biosensor desarrollado puede ser empleado como método analítico rápido y sencillo en la determinación directa de lactato en procesos de control alimentario. Por este motivo, se aplicó en la determinación de lactato en distintos alimentos o bebidas, en concreto, vino blanco, cerveza y yogur. 212

224 Síntesis de nanopartículas de oro con 3,4-DHS El único tratamiento de la muestra para llevar a cabo la determinación de lactato fue la dilución en tampón fosfato 0.1 M ph 7.0 (25 µl de vino, 40 µl de cerveza o 10 µl de yogur) hasta 10 ml con el propósito de que la concentración de analito esté comprendida en el intervalo lineal de la recta de calibrado (hasta 800 µm). Para minimizar los efectos de la matriz se utilizó el método de adición estándar. La determinación se llevó a cabo utilizando cronoamperometría a +0.3 V. Los resultados obtenidos, expresados como el valor medio de tres determinaciones utilizando diferentes biosensores, se muestran en la tabla 3.7. Tabla 3.7. Determinación de lactato en diferentes muestras con el biosensor desarrollado y con un kit enzimático comercial. Contenido de lactato (g/l) Contenido de lactato (g/l) Muestra (biosensor LOx) (kit comercial) Vino blanco 1.7 ± ± 0.02 Cerveza 0.10 ± ± Yogur 5.4 ± ± 0.4 Estos resultados se compararon con los obtenidos utilizando un kit enzimático comercial basado en L-lactato deshidrogenasa/glutamato-piruvato transaminasa y detección espectrofotométrica a 340 nm del NADH formado durante la reacción enzimática, de acuerdo con el procedimiento descrito en la sección de materiales y métodos. Los resultados obtenidos mediante el kit enzimático se encuentran resumidos en la tabla 3.7. Como se puede observar, la concentración media de lactato obtenida utilizando el biosensor concuerda con la obtenida utilizando el kit enzimático comercial, con la ventaja de que el procedimiento experimental es más rápido, directo y económico cuando se utiliza el biosensor. 213

225

226 Capítulo 4

227

228 Nanopuntos de carbono para la detección de mutaciones genéticas 4. Nanopuntos de carbono para la detección de mutaciones genéticas En este capítulo se ha estudiado la utilización de un nuevo nanomaterial de carbono, los nanopuntos de carbono, para mejorar las propiedades de los biosensores. Este nanomaterial se ha utilizado para la nanoestructuración de electrodos con el objetivo de desarrollar un biosensor de ADN sensible y selectivo. Los nanopuntos de carbono son un miembro reciente de la familia de los nanomateriales de carbono, con un tamaño inferior a 10 nm y baja toxicidad, lo que los hace muy atractivos para el estudio de sistemas biológicos. Tienen la ventaja de que se pueden sintetizar de manera sencilla a partir de diferentes fuentes de carbono para obtener nanopartículas funcionalizadas con diferentes grupos. La modificación de electrodos de oro con este material permite la inmovilización de sondas de ADN no modificadas de manera que mantienen su capacidad de reconocimiento e hibridación con la secuencia analito. En este capítulo se describe el desarrollo de un biosensor electroquímico de ADN capaz de detectar mutaciones genéticas en secuencias de más de 300 bases utilizando safranina como indicador del evento de hibridación. 4.1 Síntesis y caracterización de los nanopuntos de carbono La síntesis de los nanotubos de carbono (CDs) se llevó a cabo mediante carbonización térmica de dos moléculas orgánicas sencillas, como se muestra en la figura 4.1, según el procedimiento descrito en la sección de materiales y métodos. En muchos métodos de síntesis de CDs es necesaria una etapa de pasivación de la superficie para obtener los grupos superficiales deseados [Peng, 2009; Sun, 2006], sin embargo, en este caso, la síntesis de los CDs y la pasivación de la superficie se llevan a cabo en un solo paso. Como fuente de carbono se utilizó el ácido etilenglicolbis(β-aminoetiléter)-n,n,n',n'-tetraacético (EGTA) y como agente pasivador de la 217

229 Resultados y discusión. Capítulo 4 superficie, el tris(hidroximetil)aminometano (Tris). Tras el proceso de purificación mediante diálisis, se obtuvo una dispersión de color amarillo anaranjado ºC O C NH 2 HO OH HO H 2 N C O OH Fig Reacción de síntesis de los nanopuntos de carbono Caracterización mediante espectroscopía de infrarrojo (FTIR) Se utilizó la espectroscopía FTIR para investigar los grupos funcionales presentes en los CDs. A modo de comparación, se registraron también los espectros de sus precursores: Tris y EGTA. Los espectros FTIR de los tres compuestos se muestran en la figura Número N o de onda (cm -1 )) Fig Espectro FTIR de los nanopuntos sintetizados ( ) y sus precursores, EGTA ( ) y Tris ( ). En el espectro de los CDs ( ) las bandas a cm -1 se asignan a las vibraciones de tensión C-H y las bandas a cm -1, a la tensión C-OH. Se 218

230 Nanopuntos de carbono para la detección de mutaciones genéticas observan, además, las bandas de tensión C=O a 1650 cm -1 y de N-H a 1543 cm -1. Las bandas anchas observadas a 3390 y 3270 cm -1 se asignan a la tensión de los grupos -OH y -NH, respectivamente. Esta banda de -NH aparece desplazada con respecto a la banda correspondiente a la tensión del grupo -NH 2 en el espectro del Tris ( ), donde aparece a 3186 cm -1. Esto indica que en los CDs ese grupo está unido a un grupo funcional distinto, lo que sugiere que forma parte de un grupo amida. Por otro lado, en el espectro de los CDs no se observan las bandas entre 1300 y 1400 cm -1 que aparecen en el espectro del EGTA ( ) y corresponden a las tensiones simétrica y asimétrica del grupo carboxilato, confirmando la ausencia de este grupo en la superficie de los CDs. La asignación de las bandas presentes en el espectro de los CDs se muestra en la tabla 4.1. Tabla 4.1. Modos vibracionales presentes en el espectro FTIR de los CDs. banda IR (cm -1 ) modo vibracional C-O 1543 δ N-H 1650 C=O C-H 3270 N-H 3390 O-H Estos resultados indican que los CDs se encuentran rodeados de grupos -OH y -CONH 2, como se muestra en la figura 4.1. La presencia de estos grupos funcionales explica la buena solubilidad de los CDs en agua Caracterización mediante dispersión de luz dinámica (DLS) El tamaño de los CDs se determinó mediante análisis por dispersión de la luz dinámica (DLS). DLS es una técnica que permite obtener un perfil de distribución de tamaño de partículas pequeñas en suspensión. Se basa en la dispersión, en un determinado ángulo, de un haz de luz monocromática al incidir sobre una muestra [Berne, 1976]. 219

231 Frecuencia (%) Resultados y discusión. Capítulo Tamano Tamaño de particula partícula (nm) Fig Distribución de tamaño de los nanopuntos sintetizados obtenida mediante DLS. En la figura 4.3 se muestra el histograma de distribución de tamaños de los CDs sintetizados. Se obtuvo una distribución de tamaños entre 2 y 5 nm. Se puede observar que las nanopartículas obtenidas son monodispersas, con un diámetro medio de 3.4 ± 0.5 nm Caracterización mediante análisis elemental La composición de los CDs se estudió mediante análisis elemental. Los resultados obtenidos indican que los CDs están compuestos por carbono en un 55.10%, nitrógeno en un 0.29% e hidrógeno en un 10.17%, mientras que el 34.44% restante corresponde a oxígeno. Los nanopuntos de carbono también se llaman nanopuntos carbogénicos debido al alto contenido en oxígeno que presentan comparado con los nanodiamantes, que generalmente están formados por carbono en un 98% [Bourlinos, 2008; Liu, 2011b]. Los datos del análisis elemental se utilizaron para estimar la concentración de los CDs en la dispersión. Para ello, además de la composición, se tuvieron en cuenta la masa inicial de los reactivos y el tamaño obtenido para los CDs. De esta manera, según se describe en la sección de materiales y métodos, la concentración de los CDs en la dispersión se estimó en 277 µm. 220

232 Cuentas (kcts) Nanopuntos de carbono para la detección de mutaciones genéticas Caracterización mediante potencial Zeta El potencial zeta es un parámetro importante relacionado con la estabilidad o agregación en una dispersión. Este potencial es una medida de la carga superficial de las partículas en una dispersión y puede tener implicaciones importantes en el comportamiento del producto, ya que es una medida de la magnitud de la repulsión o atracción electrostáticas o de carga entre partículas. Así, un valor absoluto elevado del potencial zeta indica una alta repulsión entre las partículas, lo que las mantiene en suspensión, mientras que un valor bajo significa que no hay fuerzas entre ellas y es probable que se agreguen. El potencial zeta obtenido fue de -26 ± 0.3 mv (figura 4.4 ), debido a la presencia de grupos -OH y -CONH 2. Esta carga negativa contribuye a su buena dispersión en agua y confirma su estabilidad [Huang, 2012; Müller, 2001]. De hecho, el potencial zeta disminuye hasta -8.1 ± 0.2 mv tras 12 meses de almacenamiento, lo que confirma su poca tendencia a la agregación (figura 4.4 ) Potencial Zeta (mv) Fig Potencial Zeta de los nanopuntos tras la síntesis ( ) y tras 12 meses ( ) Caracterización mediante TEM Se realizó también una caracterización morfológica de los CDs mediante TEM y las imágenes obtenidas se muestran en la figura 4.5. Se puede observar que los CDs son en su mayoría esféricos. A partir de estas imágenes se estimó su tamaño. De la medida de 20 nanopuntos, se estimó un tamaño medio de 3.5 nm. 221

233 Resultados y discusión. Capítulo 4 A B 2.1 Å 2 nm Fig Imágenes de TEM de los nanopuntos sintetizados. La microscopía electrónica de transmisión también permitió obtener información sobre la estructura cristalina de los CDs, ya que esta técnica se basa en la detección de los electrones que atraviesan una muestra delgada al hacer incidir un haz de electrones sobre ella. Al atravesar la muestra, estos electrones pueden ser difractados. Si la muestra es cristalina, la difracción se producirá de acuerdo a la estructura cristalina, formando un patrón de difracción. El análisis por transformada rápida de Fourier (FFT) de las imágenes de TEM obtenidas en formato digital, permitió obtener el patrón de difracción de los electrones al atravesar la muestra y, a partir de él, se estimó el espaciado interplanar de la red cristalina. El análisis por FFT de la imagen 4.5B dio como resultado un valor de 2.1 Å. Este valor es cercano al del plano (100) del grafito [Baker, 2010], confirmando la presencia de carbonos sp 2 en la estructura de los CDs Caracterización mediante espectroscopía Raman La espectroscopía Raman es una técnica poderosa para la caracterización de materiales de carbono, por lo que se utilizó para estudiar los CDs sintetizados. Como se puede ver en la figura 4.6, el espectro Raman muestra dos picos centrados a 1330 y 1602 cm -1, correspondientes a las bandas D y G, respectivamente, que son características de los materiales grafíticos. La banda G se atribuye a las vibraciones de tensión en el plano de los carbonos sp 2 y la banda D se atribuye al modo de 222

234 Intensidad Raman (u.a.) Nanopuntos de carbono para la detección de mutaciones genéticas expansión/contracción fuera del plano de los carbonos sp 2 en presencia de defectos estructurales [Ferrari, 2000]. D G Número Wavenumber de onda (cm (cm -1 ) -1 ) Fig Espectro Raman de los nanopuntos sintetizados. Los parámetros de medida fueron: láser de excitación de nm, potencia de láser de 1 mw, tiempo de integración de 0.5 s y objetivo 50x. La relación de intensidades I D /I G es un indicador de la cristalinidad o desorden en los sistemas grafíticos. Para los CDs sintetizados la relación I D /I G es ~1.22, lo que indica una estructura relativamente ordenada, probablemente debida a la presencia de grupos funcionales en su superficie provenientes de los precursores Caracterización mediante espectrofotometría Los CDs son conocidos por sus propiedades ópticas, especialmente por su fuerte fluorescencia, por lo que se conocen también como carbono fluorescente [Li, 2012]. Por este motivo, los CDs sintetizados se estudiaron mediante espectroscopía de absorción UV-visible y de fluorescencia. Los espectros obtenidos se muestran en la figura 4.7. En el espectro de absorción (A) se puede observar un pico ancho alrededor de 360 nm, adscrito a las transición n-π* de C=O, característico de los CDs [Qu, 2013]. 223

235 Absorbancia Intensidad Resultados y discusión. Capítulo A 150 B (nm) (nm) Fig Espectros de (A) absorción y (B) emisión (λ ex = 260 nm, y λ ex = 360 nm, ) de una disolución 0.56 µm de CDs en tampón fosfato 0.1 M ph 7.0. En la figura 4.7B se muestran los espectros de emisión de los CDs con diferentes longitudes de onda de excitación, 260 nm ( ) y 360 nm ( ). Se puede observar que el máximo de emisión depende de la longitud de onda de excitación: aparece a 440 nm cuando se excita a 260 nm y a 431 nm cuando se excita a 360 nm. En ambos casos se obtuvieron bandas estrechas, con una anchura similar, lo que confirma que los CDs sintetizados presentan un tamaño homogéneo, por lo que la dependencia de la fluorescencia con la longitud de onda de excitación no se debe a la existencia de CDs de diferentes tamaños [Ahmed, 2015]. Este fenómeno se puede explicar por la presencia de diferentes grupos funcionales en la superficie de los CDs de manera que la emisión se produce desde diferentes niveles de energía [Tang, 2012] y es una característica de este material, que tiene un gran potencial en diversas aplicaciones, ya que la emisión se puede regular en función de la longitud de onda de excitación y del material de partida utilizado para su síntesis. Esto hace que se puedan preparar CDs con fluorescencia a la carta. Además, los CDs tienen un gran desplazamiento de Stokes, lo que es beneficioso para poder distinguir al objetivo de la señal de fondo en técnicas de imagen [Liu, 2011a]. 224

236 Absorbancia A Nanopuntos de carbono para la detección de mutaciones genéticas Cálculo del coeficiente de extinción de los nanopuntos Con objeto de estudiar en profundidad el material sintetizado se estimó el coeficiente de extinción molar (ε) de los nanopuntos. Para ello, se registraron los espectros de absorción de dispersiones de CDs en concentraciones crecientes entre 14 y 42 µm (figura 4.8). A partir de la representación de la absorbancia a 360 nm de estas dispersiones frente a la concentración se estimó el coeficiente de extinción. El valor obtenido fue de 1.98 x10 4 M -1 cm -1. El coeficiente de extinción molar calculado se utilizó para estimar la concentración de dispersiones de CDs de concentración desconocida x x x10-5 [CNDs] (M) 42 M 14 M (nm) Fig Espectros de absorción de disoluciones de CDs en concentraciones entre 14 y 42 µm en tampón fosfato 0.1 M ph 7.0. Inserto: Absorbancia a 360 nm frente a la concentración de CDs. 4.2 Interacción de los nanopuntos de carbono con ADN En la bibliografía se encuentran referencias respecto a la interacción entre los CDs y el ADN. Estas interacciones provocan cambios en sus propiedades ópticas [Milosavljevic, 2015]. Por este motivo, se estudió la interacción entre los CDs y el ADN mediante técnicas espectrofotométricas. Para estos estudios se ha elegido un ADN de elevado peso molecular de timo de ternera (ctadn) como modelo biológico experimental. 225

237 Intensidad Resultados y discusión. Capítulo Estudio de la interacción de los CDs con ADN mediante espectrofotometría de emisión de fluorescencia Teniendo en cuenta que los CDs sintetizados presentan fluorescencia (figura 4.7) se estudió la interacción entre el ADN y los CDs mediante espectrofotometría de emisión de fluorescencia. En la figura 4.9 se muestran los espectros de emisión excitando a 260 nm dispersiones de CDs en ausencia y en presencia de concentraciones crecientes de ctadn de cadena doble (ds-ctadn) entre 60 y 750 µm, tras 24 horas de incubación para favorecer la interacción entre ellos. En ausencia de ADN ( ) se observa la banda simétrica característica de los CDs a 440 nm. A medida que se va aumentando la concentración de ADN ( ) se produce una disminución gradual de la intensidad de emisión de esa banda. Esta amortiguación de la fluorescencia observada en los CDs tras su unión con ADN se debe a una transferencia de carga fotoinducida [Wang, 2009b] entre los CDs y el ADN. En este caso el ADN actúa como aceptor de electrones y la carga se deslocaliza en el sistema π de los pares de bases [Chen, 1998] µm (nm) Fig Espectros de emisión (λ ex = 260 nm) de disoluciones de CDs 1.3 µm en ausencia ( ) y en presencia ( ) de ds-ctadn en concentraciones entre 60 y 750 µm en tampón fosfato 0.1 M ph 7.0. La fuerza de la interacción entre los CDs y el ADN se puede cuantificar mediante la constante de amortiguación (K SV ). Esta constante se puede calcular a partir de los 226

238 F 0 /F Nanopuntos de carbono para la detección de mutaciones genéticas valores de fluorescencia en el máximo de emisión (440 nm) de la figura 4.9 utilizando la ecuación de Stern-Volmer: F 0 F = 1 + K SV[ADN] donde F 0 representa la fluorescencia de los CDs en ausencia de ADN y F, la fluorescencia en presencia de concentraciones crecientes de ds-ctadn. De la representación de F 0 /F frente a la concentración de ADN para una concentración constante de CDs se obtiene la recta de la figura La pendiente de esa recta es la constante de amortiguación (K SV ), cuyo valor resultó ser x10 4 M -1. Este valor es comparable a los descritos en la bibliografía para complejos y ligandos que interaccionan fuertemente con el ADN y cuyo modo principal de interacción es la intercalación, como el pentaamín rutenio [3-(2-fenantren-9-il-vinil)-piridina], con un valor de K SV de x10 4 M -1 [García, 2008a] o el cloruro de (9-antril)metilamonio, el cloruro de N-etil-(9-antril)metilamonio y el cloruro de 3-(9-antril)propilamonio, con valores de K SV de 1.0 x10 4, 1.2 x10 4, and 1.4 x10 4 M -1, respectivamente [Kumar, 2000] [ADN] ( M) Fig Representación de la relación de intensidades de fluorescencia a 440 nm entre la disolución que solo contiene CDs y las que contienen CDs y ds-ctadn frente a la concentración de ADN. 227

239 Resultados y discusión. Capítulo Estudio de la temperatura de desnaturalización El ADN está formado por dos cadenas complementarias unidas entre sí mediante enlaces de hidrógeno. El aumento de la temperatura puede provocar la ruptura de esos enlaces de hidrógeno, de manera que las dos cadenas se separan. La temperatura a la que la mitad de las cadenas se encuentran desnaturalizadas, es decir, como cadenas sencillas, se conoce como temperatura de desnaturalización. La interacción del ADN con otros compuestos da lugar a que se fortalezcan o se debiliten las uniones de la doble cadena, por lo tanto, puede provocar variaciones en esta temperatura. Normalmente, cuando la interacción se produce por intercalación del compuesto entre las bases, se produce una estabilización de la doble hélice, lo que conduce a un aumento de la temperatura de desnaturalización [Waring, 1965]. Por tanto, la determinación de la temperatura de desnaturalización es una forma de elucidar la interacción del ADN con un determinado compuesto. De acuerdo con esto, la diferencia en la temperatura de desnaturalización del ADN en ausencia y en presencia de nanopuntos de carbono puede dar una idea del modo de interacción entre ellos. La temperatura de desnaturalización del ADN, tanto en ausencia como en presencia de CDs, se determinó midiendo la absorbancia de la banda de ADN a 260 nm de una disolución que solo contenía ds-ctadn y otra que contenía ds-ctadn y CDs a medida que se va aumentando gradualmente la temperatura. En la figura 4.11 se muestran las curvas de desnaturalización, que son una representación de la absorbancia relativa frente a la temperatura, donde la absorbancia relativa es la relación entre la absorbancia del ADN para cada temperatura (A) y la absorbancia del ADN a la temperatura inicial (A 0 ). A partir del punto medio de la transición hipercrómica se calculó la temperatura de desnaturalización. En la gráfica se observa que la temperatura de desnaturalización es prácticamente la misma (67 ºC) en ausencia ( ) y en presencia ( ) de los CDs. Este resultado no concuerda con lo esperado para un modo de interacción intercalativo. 228

240 Nanopuntos de carbono para la detección de mutaciones genéticas 1.4 A/A Temperatura ( o C) Fig Representación de la absorbancia relativa frente a la temperatura de una disolución 60 µm de ds-ctadn en ausencia ( ) y en presencia ( ) de CDs 17 µm en tampón fosfato 0.1 M ph Nanoestructuración del electrodo Los CDs sintetizados se emplearon para la nanoestructuración de electrodos con la idea de incorporar las ventajas de los nanomateriales al desarrollo de dispositivos sensores electroquímicos. Se modificaron electrodos serigrafiados de oro con nanopuntos de carbono, siguiendo el procedimiento descrito en la sección de materiales y métodos. Los electrodos nanoestructurados resultantes se caracterizaron morfológicamente mediante microscopía de barrido electrónico (SEM). También se estudiaron sus propiedades electroquímicas mediante voltamperometría cíclica Caracterización morfológica de la superficie nanoestructurada mediante SEM Para obtener una idea de la disposición de los CDs sobre la superficie del electrodo nanoestructurado se obtuvieron las imágenes de SEM. En la figura 4.12 se muestra la imagen de los CDs depositados sobre una superficie de oro con distinto nivel de magnificación. Se puede observar que la superficie de oro se encuentra parcialmente cubierta por los CDs, que se pueden distinguir claramente como puntos distribuidos 229

241 Resultados y discusión. Capítulo 4 aleatoriamente sobre la superficie del oro. Además, se puede apreciar que los CDs presentan un tamaño homogéneo, con una morfología casi esférica. A B Fig Imágenes de SEM de los CDs sintetizados depositados sobre un sustrato de oro a con una magnificación de (A) x y (B) x Caracterización de los electrodos nanoestructurados mediante voltamperometría cíclica Se espera que la nanoestructuración de los electrodos serigrafiados de oro con los CDs afecte a sus propiedades electroquímicas, por lo que se estudió su respuesta ciclovoltamperométrica en ácido sulfúrico 0.1 M y se comparó con el ciclovoltamperograma de un electrodo de oro sin modificar en el mismo medio. Como se puede observar en la figura 4.13 ( ), el voltamperograma característico del oro cambia tras la modificación con los CDs ( ). En el electrodo nanoestructurado la onda de oxidación aumenta en intensidad y se desplaza a potenciales más positivos, de 0.81 V a 0.87 V. Sin embargo, el pico agudo de reducción disminuye en intensidad y se desplaza a potenciales más positivos. Este comportamiento indica que se ha producido un cambio en la superficie del electrodo al estar presentes los CDs, de manera que se obtiene una superficie mixta de oro y carbono. 230

Sitemap